Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639594_at:

>probe:Drosophila_2:1639594_at:594:721; Interrogation_Position=1050; Antisense; TTGCTTTTACAAACTTCGATCTCTG
>probe:Drosophila_2:1639594_at:331:149; Interrogation_Position=1062; Antisense; ACTTCGATCTCTGTTCTGACGATAA
>probe:Drosophila_2:1639594_at:451:511; Interrogation_Position=1116; Antisense; GTGAAACAGTTTTGATGCCGCACAA
>probe:Drosophila_2:1639594_at:210:51; Interrogation_Position=1130; Antisense; ATGCCGCACAAAGTGCATCCACAGA
>probe:Drosophila_2:1639594_at:163:385; Interrogation_Position=1153; Antisense; GAACTTGGAGATAGCTTGACGAATT
>probe:Drosophila_2:1639594_at:651:301; Interrogation_Position=1200; Antisense; CCCCGTCTAGGTTAATAATGTGAAT
>probe:Drosophila_2:1639594_at:295:241; Interrogation_Position=1229; Antisense; AATATTATTTCCATACTCGTCCCTC
>probe:Drosophila_2:1639594_at:330:669; Interrogation_Position=1242; Antisense; TACTCGTCCCTCTGTGTTATCTATA
>probe:Drosophila_2:1639594_at:363:281; Interrogation_Position=1251; Antisense; CTCTGTGTTATCTATACGCCTGTTA
>probe:Drosophila_2:1639594_at:101:665; Interrogation_Position=1298; Antisense; TAAATTGTTCATTGCTTAGCTGTTT
>probe:Drosophila_2:1639594_at:239:479; Interrogation_Position=1381; Antisense; GTATTTACAACTGCATAACTCGTTC
>probe:Drosophila_2:1639594_at:512:251; Interrogation_Position=1393; Antisense; GCATAACTCGTTCTTAACTACTTTT
>probe:Drosophila_2:1639594_at:230:139; Interrogation_Position=894; Antisense; ACGGATCCAATGTCTGAAATGTCTT
>probe:Drosophila_2:1639594_at:382:511; Interrogation_Position=930; Antisense; GTGACAATTTTCATTATACCATACT

Paste this into a BLAST search page for me
TTGCTTTTACAAACTTCGATCTCTGACTTCGATCTCTGTTCTGACGATAAGTGAAACAGTTTTGATGCCGCACAAATGCCGCACAAAGTGCATCCACAGAGAACTTGGAGATAGCTTGACGAATTCCCCGTCTAGGTTAATAATGTGAATAATATTATTTCCATACTCGTCCCTCTACTCGTCCCTCTGTGTTATCTATACTCTGTGTTATCTATACGCCTGTTATAAATTGTTCATTGCTTAGCTGTTTGTATTTACAACTGCATAACTCGTTCGCATAACTCGTTCTTAACTACTTTTACGGATCCAATGTCTGAAATGTCTTGTGACAATTTTCATTATACCATACT

Full Affymetrix probeset data:

Annotations for 1639594_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime