Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639596_at:

>probe:Drosophila_2:1639596_at:381:697; Interrogation_Position=1303; Antisense; TTTTATTTAACACAAGACTCGAACT
>probe:Drosophila_2:1639596_at:560:279; Interrogation_Position=1326; Antisense; CTAAATTTCGGCAATAGCTAACATT
>probe:Drosophila_2:1639596_at:340:697; Interrogation_Position=1366; Antisense; TTTAACGTAATGCTCAACGAGGCGA
>probe:Drosophila_2:1639596_at:215:253; Interrogation_Position=1380; Antisense; CAACGAGGCGAACACTTCATAGAAT
>probe:Drosophila_2:1639596_at:210:359; Interrogation_Position=1410; Antisense; GCAAGCAATTGGGTCGAAGGTCGTC
>probe:Drosophila_2:1639596_at:148:369; Interrogation_Position=1425; Antisense; GAAGGTCGTCCCTGGATAATCCAAA
>probe:Drosophila_2:1639596_at:703:309; Interrogation_Position=1445; Antisense; CCAAAATGATAGTTGTGACACGCTT
>probe:Drosophila_2:1639596_at:692:177; Interrogation_Position=1518; Antisense; AAACACTCGTTGTTGTAACCAACTG
>probe:Drosophila_2:1639596_at:39:355; Interrogation_Position=1529; Antisense; GTTGTAACCAACTGCCAAAAAGGAT
>probe:Drosophila_2:1639596_at:48:615; Interrogation_Position=1559; Antisense; TGAAGTCGTTTCATCTACCGCATAG
>probe:Drosophila_2:1639596_at:646:353; Interrogation_Position=1584; Antisense; GCACCACCATCCCAGCAATGAGAAA
>probe:Drosophila_2:1639596_at:652:443; Interrogation_Position=1657; Antisense; TGAAACCTTTTTGTCCAAAGTAGCA
>probe:Drosophila_2:1639596_at:387:667; Interrogation_Position=1745; Antisense; TACATTGTTTTTAGTTCTTTTAGCA
>probe:Drosophila_2:1639596_at:283:109; Interrogation_Position=1804; Antisense; AGAATCTCCTCTTAAATGCAATATT

Paste this into a BLAST search page for me
TTTTATTTAACACAAGACTCGAACTCTAAATTTCGGCAATAGCTAACATTTTTAACGTAATGCTCAACGAGGCGACAACGAGGCGAACACTTCATAGAATGCAAGCAATTGGGTCGAAGGTCGTCGAAGGTCGTCCCTGGATAATCCAAACCAAAATGATAGTTGTGACACGCTTAAACACTCGTTGTTGTAACCAACTGGTTGTAACCAACTGCCAAAAAGGATTGAAGTCGTTTCATCTACCGCATAGGCACCACCATCCCAGCAATGAGAAATGAAACCTTTTTGTCCAAAGTAGCATACATTGTTTTTAGTTCTTTTAGCAAGAATCTCCTCTTAAATGCAATATT

Full Affymetrix probeset data:

Annotations for 1639596_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime