FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639597_at:

>probe:Drosophila_2:1639597_at:593:303; Interrogation_Position=169; Antisense; CCGAGGATCTGCAGAGCGCGCGCAA
>probe:Drosophila_2:1639597_at:300:85; Interrogation_Position=196; Antisense; AGTGTGCCGCCAGCAGCAAGGTGAC
>probe:Drosophila_2:1639597_at:87:219; Interrogation_Position=237; Antisense; AAGTACAAGACCTTCGACTATCCCG
>probe:Drosophila_2:1639597_at:328:245; Interrogation_Position=304; Antisense; AATTCGACCTGTTCGATGAGGCCAA
>probe:Drosophila_2:1639597_at:91:109; Interrogation_Position=421; Antisense; AGAACGAGCAGAAGTCGCCCGCCAA
>probe:Drosophila_2:1639597_at:673:197; Interrogation_Position=444; Antisense; AACGAATGGGCCTTCCGTGGCTTCA
>probe:Drosophila_2:1639597_at:31:517; Interrogation_Position=460; Antisense; GTGGCTTCAAGTGTTTCCTTGGCAA
>probe:Drosophila_2:1639597_at:174:349; Interrogation_Position=500; Antisense; GCAGGCCGCCGTCCAGAAGAACTAG
>probe:Drosophila_2:1639597_at:299:191; Interrogation_Position=519; Antisense; AACTAGGAGTTCAGCGCAGTTCCAC
>probe:Drosophila_2:1639597_at:445:123; Interrogation_Position=531; Antisense; AGCGCAGTTCCACATCAATTCTAGA
>probe:Drosophila_2:1639597_at:228:209; Interrogation_Position=578; Antisense; AAGCAACGCGGCATTTTCGAGTTGA
>probe:Drosophila_2:1639597_at:543:637; Interrogation_Position=594; Antisense; TCGAGTTGAAATCCGCTCAGGCTCT
>probe:Drosophila_2:1639597_at:212:649; Interrogation_Position=610; Antisense; TCAGGCTCTGCAATCCTACGATTGA
>probe:Drosophila_2:1639597_at:448:211; Interrogation_Position=96; Antisense; AAGAACGCTGTTGCTATTCTGCTGT

Paste this into a BLAST search page for me
CCGAGGATCTGCAGAGCGCGCGCAAAGTGTGCCGCCAGCAGCAAGGTGACAAGTACAAGACCTTCGACTATCCCGAATTCGACCTGTTCGATGAGGCCAAAGAACGAGCAGAAGTCGCCCGCCAAAACGAATGGGCCTTCCGTGGCTTCAGTGGCTTCAAGTGTTTCCTTGGCAAGCAGGCCGCCGTCCAGAAGAACTAGAACTAGGAGTTCAGCGCAGTTCCACAGCGCAGTTCCACATCAATTCTAGAAAGCAACGCGGCATTTTCGAGTTGATCGAGTTGAAATCCGCTCAGGCTCTTCAGGCTCTGCAATCCTACGATTGAAAGAACGCTGTTGCTATTCTGCTGT

Full Affymetrix probeset data:

Annotations for 1639597_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720