Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639598_at:

>probe:Drosophila_2:1639598_at:375:423; Interrogation_Position=115; Antisense; GAGAAGCATGGAAGTCCGCCTCTGA
>probe:Drosophila_2:1639598_at:440:281; Interrogation_Position=134; Antisense; CTCTGACCTTGGACGATGAACTCAC
>probe:Drosophila_2:1639598_at:3:421; Interrogation_Position=208; Antisense; GAGCATTCAAGTTCTGCCGGTCAAA
>probe:Drosophila_2:1639598_at:675:175; Interrogation_Position=263; Antisense; AAACCCCTCTGCAATGTGTTCAAGA
>probe:Drosophila_2:1639598_at:443:395; Interrogation_Position=298; Antisense; GAAATCGCGGACTACGACTTTGAAA
>probe:Drosophila_2:1639598_at:32:175; Interrogation_Position=321; Antisense; AAAGCCACAGTTTGCAATGTCAACG
>probe:Drosophila_2:1639598_at:110:231; Interrogation_Position=336; Antisense; AATGTCAACGGGTCATTTCACCGCC
>probe:Drosophila_2:1639598_at:204:709; Interrogation_Position=352; Antisense; TTCACCGCCCTCGTTTGGAAGAATG
>probe:Drosophila_2:1639598_at:686:387; Interrogation_Position=475; Antisense; GAAAATGTTCTTCCGCCGATCAAAG
>probe:Drosophila_2:1639598_at:166:691; Interrogation_Position=552; Antisense; TATTCCCATCATAGTCATGCTTTGG
>probe:Drosophila_2:1639598_at:185:271; Interrogation_Position=567; Antisense; CATGCTTTGGTTATGCTGGCAATTC
>probe:Drosophila_2:1639598_at:582:257; Interrogation_Position=611; Antisense; CACTTTGAAGTTTTTGTGCCGCAGT
>probe:Drosophila_2:1639598_at:586:505; Interrogation_Position=626; Antisense; GTGCCGCAGTTCTTGTAAATTTGTA
>probe:Drosophila_2:1639598_at:105:335; Interrogation_Position=70; Antisense; GCTGATCTTCAGGAGGACCATCTAA

Paste this into a BLAST search page for me
GAGAAGCATGGAAGTCCGCCTCTGACTCTGACCTTGGACGATGAACTCACGAGCATTCAAGTTCTGCCGGTCAAAAAACCCCTCTGCAATGTGTTCAAGAGAAATCGCGGACTACGACTTTGAAAAAAGCCACAGTTTGCAATGTCAACGAATGTCAACGGGTCATTTCACCGCCTTCACCGCCCTCGTTTGGAAGAATGGAAAATGTTCTTCCGCCGATCAAAGTATTCCCATCATAGTCATGCTTTGGCATGCTTTGGTTATGCTGGCAATTCCACTTTGAAGTTTTTGTGCCGCAGTGTGCCGCAGTTCTTGTAAATTTGTAGCTGATCTTCAGGAGGACCATCTAA

Full Affymetrix probeset data:

Annotations for 1639598_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime