FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639599_at:

>probe:Drosophila_2:1639599_at:441:377; Interrogation_Position=2764; Antisense; GAAGCACTTGAAGATGTCCACTCTG
>probe:Drosophila_2:1639599_at:284:505; Interrogation_Position=2779; Antisense; GTCCACTCTGCACAAGGAGAACCTG
>probe:Drosophila_2:1639599_at:304:439; Interrogation_Position=2840; Antisense; GAGGCACTAGCCTATCGTGATCGTG
>probe:Drosophila_2:1639599_at:156:107; Interrogation_Position=2946; Antisense; AGACACTGCAGTCGCGGCAAAAGCA
>probe:Drosophila_2:1639599_at:70:183; Interrogation_Position=2964; Antisense; AAAAGCAGTCTACTAGCGCTACTCC
>probe:Drosophila_2:1639599_at:438:467; Interrogation_Position=3003; Antisense; GTTCGAGCAACGTGGGCAGTCGACT
>probe:Drosophila_2:1639599_at:267:349; Interrogation_Position=3018; Antisense; GCAGTCGACTGCTCCAAAAGATGGG
>probe:Drosophila_2:1639599_at:79:677; Interrogation_Position=3096; Antisense; TAGAGGCGGACGGACGCTCCAATTA
>probe:Drosophila_2:1639599_at:635:317; Interrogation_Position=3111; Antisense; GCTCCAATTACGTGGGCTTGGGCAA
>probe:Drosophila_2:1639599_at:88:455; Interrogation_Position=3151; Antisense; GATACCGGGCAACGACTACAAATCC
>probe:Drosophila_2:1639599_at:119:477; Interrogation_Position=3225; Antisense; GTTTTTAGCCGTTTCACATGTTTCA
>probe:Drosophila_2:1639599_at:17:477; Interrogation_Position=3244; Antisense; GTTTCATTTCAACTAAAGTCGCCGT
>probe:Drosophila_2:1639599_at:64:503; Interrogation_Position=3261; Antisense; GTCGCCGTTTAATTCAGCTTTTCAA
>probe:Drosophila_2:1639599_at:192:117; Interrogation_Position=3319; Antisense; AGCTTCTTGAGCATTGTTTTCCTAA

Paste this into a BLAST search page for me
GAAGCACTTGAAGATGTCCACTCTGGTCCACTCTGCACAAGGAGAACCTGGAGGCACTAGCCTATCGTGATCGTGAGACACTGCAGTCGCGGCAAAAGCAAAAAGCAGTCTACTAGCGCTACTCCGTTCGAGCAACGTGGGCAGTCGACTGCAGTCGACTGCTCCAAAAGATGGGTAGAGGCGGACGGACGCTCCAATTAGCTCCAATTACGTGGGCTTGGGCAAGATACCGGGCAACGACTACAAATCCGTTTTTAGCCGTTTCACATGTTTCAGTTTCATTTCAACTAAAGTCGCCGTGTCGCCGTTTAATTCAGCTTTTCAAAGCTTCTTGAGCATTGTTTTCCTAA

Full Affymetrix probeset data:

Annotations for 1639599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720