FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639600_at:

>probe:Drosophila_2:1639600_at:196:585; Interrogation_Position=103; Antisense; TGGAATTGGTTCGTCACCTTTACGC
>probe:Drosophila_2:1639600_at:639:145; Interrogation_Position=129; Antisense; ACTCTGGTTCTTCGATGTGATCATT
>probe:Drosophila_2:1639600_at:61:219; Interrogation_Position=184; Antisense; AAGTGGCGGAACCTAACCTGCCTGA
>probe:Drosophila_2:1639600_at:93:451; Interrogation_Position=211; Antisense; GATCTCCTGTTCCTCTACAAATGGA
>probe:Drosophila_2:1639600_at:138:169; Interrogation_Position=229; Antisense; AAATGGAACATTGCCGGCGTCCTGC
>probe:Drosophila_2:1639600_at:349:609; Interrogation_Position=254; Antisense; TGACCATCGCCTCCCAAGTGATGAT
>probe:Drosophila_2:1639600_at:143:221; Interrogation_Position=269; Antisense; AAGTGATGATCTGCCTAACGCTGGA
>probe:Drosophila_2:1639600_at:133:201; Interrogation_Position=285; Antisense; AACGCTGGAGTACCCGCAACAGATT
>probe:Drosophila_2:1639600_at:628:523; Interrogation_Position=29; Antisense; GGGCGCTCTTCACTTGGTTTATCGT
>probe:Drosophila_2:1639600_at:153:265; Interrogation_Position=304; Antisense; CAGATTCCCATATACGTGACCGTTG
>probe:Drosophila_2:1639600_at:513:607; Interrogation_Position=347; Antisense; TGAGCACCGCCATCTTCTATGTTGG
>probe:Drosophila_2:1639600_at:583:271; Interrogation_Position=357; Antisense; CATCTTCTATGTTGGCAGCAGGCTG
>probe:Drosophila_2:1639600_at:305:589; Interrogation_Position=43; Antisense; TGGTTTATCGTCCTGGTCTTCCTGA
>probe:Drosophila_2:1639600_at:360:591; Interrogation_Position=56; Antisense; TGGTCTTCCTGATTCTTCTGTGTCT

Paste this into a BLAST search page for me
TGGAATTGGTTCGTCACCTTTACGCACTCTGGTTCTTCGATGTGATCATTAAGTGGCGGAACCTAACCTGCCTGAGATCTCCTGTTCCTCTACAAATGGAAAATGGAACATTGCCGGCGTCCTGCTGACCATCGCCTCCCAAGTGATGATAAGTGATGATCTGCCTAACGCTGGAAACGCTGGAGTACCCGCAACAGATTGGGCGCTCTTCACTTGGTTTATCGTCAGATTCCCATATACGTGACCGTTGTGAGCACCGCCATCTTCTATGTTGGCATCTTCTATGTTGGCAGCAGGCTGTGGTTTATCGTCCTGGTCTTCCTGATGGTCTTCCTGATTCTTCTGTGTCT

Full Affymetrix probeset data:

Annotations for 1639600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720