FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639604_at:

>probe:Drosophila_2:1639604_at:471:171; Interrogation_Position=1018; Antisense; AAAGATGTCCTCTATGGCTGAGATG
>probe:Drosophila_2:1639604_at:537:373; Interrogation_Position=547; Antisense; GAAGTCCTTGTACGGCTGCGAGCAT
>probe:Drosophila_2:1639604_at:448:267; Interrogation_Position=595; Antisense; CAGGATTGTGCCGTGCAAGCCAAAA
>probe:Drosophila_2:1639604_at:112:267; Interrogation_Position=628; Antisense; CAGTGATATTGTTGACCAGGTCGCC
>probe:Drosophila_2:1639604_at:92:185; Interrogation_Position=661; Antisense; AAAATCGAGCTGCACATGCGCGTTT
>probe:Drosophila_2:1639604_at:597:323; Interrogation_Position=678; Antisense; GCGCGTTTCGCGATGTCATTGGTGA
>probe:Drosophila_2:1639604_at:135:593; Interrogation_Position=697; Antisense; TGGTGAATGCAACGCCATGCTCGAC
>probe:Drosophila_2:1639604_at:59:241; Interrogation_Position=746; Antisense; AATAGCTGGCACTTGTCGAGGAACA
>probe:Drosophila_2:1639604_at:639:153; Interrogation_Position=768; Antisense; ACAGCAGTTCATCGAAGGCTCGCCA
>probe:Drosophila_2:1639604_at:41:707; Interrogation_Position=806; Antisense; TTAGAGGTGCCAGGACCTTCGGGAT
>probe:Drosophila_2:1639604_at:306:717; Interrogation_Position=823; Antisense; TTCGGGATCCGCACAGAGCCATAAG
>probe:Drosophila_2:1639604_at:493:97; Interrogation_Position=846; Antisense; AGATCGACACCTTGGGAGTTTCTGC
>probe:Drosophila_2:1639604_at:18:115; Interrogation_Position=921; Antisense; AGCAGGCCAGCTACAATTCGACGAG
>probe:Drosophila_2:1639604_at:49:117; Interrogation_Position=986; Antisense; AGCTACTTCGACACCATTGTTCATA

Paste this into a BLAST search page for me
AAAGATGTCCTCTATGGCTGAGATGGAAGTCCTTGTACGGCTGCGAGCATCAGGATTGTGCCGTGCAAGCCAAAACAGTGATATTGTTGACCAGGTCGCCAAAATCGAGCTGCACATGCGCGTTTGCGCGTTTCGCGATGTCATTGGTGATGGTGAATGCAACGCCATGCTCGACAATAGCTGGCACTTGTCGAGGAACAACAGCAGTTCATCGAAGGCTCGCCATTAGAGGTGCCAGGACCTTCGGGATTTCGGGATCCGCACAGAGCCATAAGAGATCGACACCTTGGGAGTTTCTGCAGCAGGCCAGCTACAATTCGACGAGAGCTACTTCGACACCATTGTTCATA

Full Affymetrix probeset data:

Annotations for 1639604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720