FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639605_at:

>probe:Drosophila_2:1639605_at:597:87; Interrogation_Position=197; Antisense; AGTCACTGTCCGCACTGGAGAGTGC
>probe:Drosophila_2:1639605_at:336:609; Interrogation_Position=269; Antisense; TGAGAGAGACGTGCAGCGCCAACTC
>probe:Drosophila_2:1639605_at:160:311; Interrogation_Position=286; Antisense; GCCAACTCCAGTCCGAAATTGTTTC
>probe:Drosophila_2:1639605_at:420:589; Interrogation_Position=332; Antisense; TGGATAATCTCAGCCTAGCCGAGCA
>probe:Drosophila_2:1639605_at:709:687; Interrogation_Position=382; Antisense; TTTCAAGCGGGCATTCCCAGGGAAA
>probe:Drosophila_2:1639605_at:484:515; Interrogation_Position=401; Antisense; GGGAAATATCCCTGGAGGCCCTGTC
>probe:Drosophila_2:1639605_at:628:397; Interrogation_Position=428; Antisense; GACAGAGTCCAGGTGCGTTTCTAGT
>probe:Drosophila_2:1639605_at:78:621; Interrogation_Position=441; Antisense; TGCGTTTCTAGTGCGCCAGAGCAGC
>probe:Drosophila_2:1639605_at:313:419; Interrogation_Position=459; Antisense; GAGCAGCACAAAGCCGGGATGTTTC
>probe:Drosophila_2:1639605_at:689:145; Interrogation_Position=527; Antisense; ACTATCTGATCCTGCGGACGCAAAG
>probe:Drosophila_2:1639605_at:547:275; Interrogation_Position=570; Antisense; CTTCACCAAGGAGTTCAGTTCGCTG
>probe:Drosophila_2:1639605_at:303:449; Interrogation_Position=674; Antisense; GATCGCAACGATCGCAGGGCGCCTA
>probe:Drosophila_2:1639605_at:457:59; Interrogation_Position=736; Antisense; ATGTATGGCTCGCTGAACGACTTTC
>probe:Drosophila_2:1639605_at:100:199; Interrogation_Position=751; Antisense; AACGACTTTCGCAAAATGATGGCCG

Paste this into a BLAST search page for me
AGTCACTGTCCGCACTGGAGAGTGCTGAGAGAGACGTGCAGCGCCAACTCGCCAACTCCAGTCCGAAATTGTTTCTGGATAATCTCAGCCTAGCCGAGCATTTCAAGCGGGCATTCCCAGGGAAAGGGAAATATCCCTGGAGGCCCTGTCGACAGAGTCCAGGTGCGTTTCTAGTTGCGTTTCTAGTGCGCCAGAGCAGCGAGCAGCACAAAGCCGGGATGTTTCACTATCTGATCCTGCGGACGCAAAGCTTCACCAAGGAGTTCAGTTCGCTGGATCGCAACGATCGCAGGGCGCCTAATGTATGGCTCGCTGAACGACTTTCAACGACTTTCGCAAAATGATGGCCG

Full Affymetrix probeset data:

Annotations for 1639605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720