Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639607_at:

>probe:Drosophila_2:1639607_at:80:253; Interrogation_Position=2185; Antisense; CAAGAATTACTGCTGATCGGCGAAT
>probe:Drosophila_2:1639607_at:272:107; Interrogation_Position=2230; Antisense; AGAAGCGAATTTAAAGTGCCCGATC
>probe:Drosophila_2:1639607_at:449:169; Interrogation_Position=2242; Antisense; AAAGTGCCCGATCGTCGGTTCTGGT
>probe:Drosophila_2:1639607_at:139:541; Interrogation_Position=2258; Antisense; GGTTCTGGTGGCTACGAATCCTCAC
>probe:Drosophila_2:1639607_at:625:367; Interrogation_Position=2273; Antisense; GAATCCTCACACTTTCTAGTCAACA
>probe:Drosophila_2:1639607_at:545:271; Interrogation_Position=2343; Antisense; CATTGGCTACGATCCTTTTGTTGAG
>probe:Drosophila_2:1639607_at:394:47; Interrogation_Position=2354; Antisense; ATCCTTTTGTTGAGGTCTGCTTAAA
>probe:Drosophila_2:1639607_at:719:161; Interrogation_Position=2426; Antisense; ACAATCGCCGGGTCGTCTGGTATAT
>probe:Drosophila_2:1639607_at:77:709; Interrogation_Position=2465; Antisense; TTAACGAAGCCATAGATTCCGCCTT
>probe:Drosophila_2:1639607_at:627:95; Interrogation_Position=2478; Antisense; AGATTCCGCCTTCGAGCAGCGTGAT
>probe:Drosophila_2:1639607_at:283:513; Interrogation_Position=2498; Antisense; GTGATGTGCACAGTCTCTTTGAGTT
>probe:Drosophila_2:1639607_at:480:71; Interrogation_Position=2534; Antisense; AGGCGATCGTTAACAATGGCACACT
>probe:Drosophila_2:1639607_at:509:355; Interrogation_Position=2651; Antisense; GCACTCTTAAGCTTATTCGGTATTG
>probe:Drosophila_2:1639607_at:286:691; Interrogation_Position=2671; Antisense; TATTGTCAATCAGGACGTGCTCTTG

Paste this into a BLAST search page for me
CAAGAATTACTGCTGATCGGCGAATAGAAGCGAATTTAAAGTGCCCGATCAAAGTGCCCGATCGTCGGTTCTGGTGGTTCTGGTGGCTACGAATCCTCACGAATCCTCACACTTTCTAGTCAACACATTGGCTACGATCCTTTTGTTGAGATCCTTTTGTTGAGGTCTGCTTAAAACAATCGCCGGGTCGTCTGGTATATTTAACGAAGCCATAGATTCCGCCTTAGATTCCGCCTTCGAGCAGCGTGATGTGATGTGCACAGTCTCTTTGAGTTAGGCGATCGTTAACAATGGCACACTGCACTCTTAAGCTTATTCGGTATTGTATTGTCAATCAGGACGTGCTCTTG

Full Affymetrix probeset data:

Annotations for 1639607_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime