FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639608_at:

>probe:Drosophila_2:1639608_at:311:69; Interrogation_Position=1649; Antisense; ATGGCCAGCCGCAAGGATTAGGAGA
>probe:Drosophila_2:1639608_at:269:455; Interrogation_Position=1692; Antisense; GATCACACTCGCACAAATCCATGTA
>probe:Drosophila_2:1639608_at:648:723; Interrogation_Position=1806; Antisense; TTGCACATTCCATTAACCATCACAT
>probe:Drosophila_2:1639608_at:665:541; Interrogation_Position=1837; Antisense; GGTTGTGGACCAAATGCGTGCGTTT
>probe:Drosophila_2:1639608_at:540:589; Interrogation_Position=1861; Antisense; TGGTTCGCACCCGTTATTCTCTATT
>probe:Drosophila_2:1639608_at:73:691; Interrogation_Position=1875; Antisense; TATTCTCTATTTTCCGCCTTTTGTA
>probe:Drosophila_2:1639608_at:637:661; Interrogation_Position=1915; Antisense; TAAAATCCTGTTCTCCTAGCGGTAT
>probe:Drosophila_2:1639608_at:604:657; Interrogation_Position=1990; Antisense; TAAGTGCTCCTTTCCACACGTATAA
>probe:Drosophila_2:1639608_at:548:485; Interrogation_Position=2047; Antisense; GTAGACATTATTTTCCCCATCTGAC
>probe:Drosophila_2:1639608_at:49:271; Interrogation_Position=2064; Antisense; CATCTGACTTTCTTTTCAGCAGCTC
>probe:Drosophila_2:1639608_at:656:337; Interrogation_Position=2085; Antisense; GCTCGCAGTGCCTACATTATTTCAA
>probe:Drosophila_2:1639608_at:628:403; Interrogation_Position=2134; Antisense; GACTAGCGATCTAAGAATCCCTGAA
>probe:Drosophila_2:1639608_at:5:367; Interrogation_Position=2148; Antisense; GAATCCCTGAATCCAGTATCTGTAT
>probe:Drosophila_2:1639608_at:193:211; Interrogation_Position=2174; Antisense; AAGAATCCCAGTATCTGAACGCTAA

Paste this into a BLAST search page for me
ATGGCCAGCCGCAAGGATTAGGAGAGATCACACTCGCACAAATCCATGTATTGCACATTCCATTAACCATCACATGGTTGTGGACCAAATGCGTGCGTTTTGGTTCGCACCCGTTATTCTCTATTTATTCTCTATTTTCCGCCTTTTGTATAAAATCCTGTTCTCCTAGCGGTATTAAGTGCTCCTTTCCACACGTATAAGTAGACATTATTTTCCCCATCTGACCATCTGACTTTCTTTTCAGCAGCTCGCTCGCAGTGCCTACATTATTTCAAGACTAGCGATCTAAGAATCCCTGAAGAATCCCTGAATCCAGTATCTGTATAAGAATCCCAGTATCTGAACGCTAA

Full Affymetrix probeset data:

Annotations for 1639608_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720