Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639609_s_at:

>probe:Drosophila_2:1639609_s_at:269:101; Interrogation_Position=128; Antisense; AGAGGGAGCGTCAGGAGGCCATCAA
>probe:Drosophila_2:1639609_s_at:651:67; Interrogation_Position=13; Antisense; ATGGCGGCCTTCATAGCTAAGCAGA
>probe:Drosophila_2:1639609_s_at:513:573; Interrogation_Position=15; Antisense; GGCGGCCTTCATAGCTAAGCAGATG
>probe:Drosophila_2:1639609_s_at:213:375; Interrogation_Position=207; Antisense; GAAGATGAGGCAAGACATTCGCGAT
>probe:Drosophila_2:1639609_s_at:275:439; Interrogation_Position=213; Antisense; GAGGCAAGACATTCGCGATAAGTAC
>probe:Drosophila_2:1639609_s_at:97:213; Interrogation_Position=218; Antisense; AAGACATTCGCGATAAGTACAACAT
>probe:Drosophila_2:1639609_s_at:162:11; Interrogation_Position=223; Antisense; ATTCGCGATAAGTACAACATCAAGA
>probe:Drosophila_2:1639609_s_at:60:27; Interrogation_Position=25; Antisense; ATAGCTAAGCAGATGGTTGGAAACC
>probe:Drosophila_2:1639609_s_at:251:311; Interrogation_Position=276; Antisense; CCAAGAAGAGCCCAATCCCCTGATG
>probe:Drosophila_2:1639609_s_at:88:115; Interrogation_Position=284; Antisense; AGCCCAATCCCCTGATGCGGAAAAA
>probe:Drosophila_2:1639609_s_at:662:233; Interrogation_Position=288; Antisense; CAATCCCCTGATGCGGAAAAAGAAG
>probe:Drosophila_2:1639609_s_at:231:209; Interrogation_Position=307; Antisense; AAGAAGACGCCCGAGGAACTCGCCG
>probe:Drosophila_2:1639609_s_at:200:537; Interrogation_Position=38; Antisense; TGGTTGGAAACCAATTAAGTGCCGT
>probe:Drosophila_2:1639609_s_at:655:47; Interrogation_Position=92; Antisense; ATGATGGCGACGACAAGGAAAAGGC

Paste this into a BLAST search page for me
AGAGGGAGCGTCAGGAGGCCATCAAATGGCGGCCTTCATAGCTAAGCAGAGGCGGCCTTCATAGCTAAGCAGATGGAAGATGAGGCAAGACATTCGCGATGAGGCAAGACATTCGCGATAAGTACAAGACATTCGCGATAAGTACAACATATTCGCGATAAGTACAACATCAAGAATAGCTAAGCAGATGGTTGGAAACCCCAAGAAGAGCCCAATCCCCTGATGAGCCCAATCCCCTGATGCGGAAAAACAATCCCCTGATGCGGAAAAAGAAGAAGAAGACGCCCGAGGAACTCGCCGTGGTTGGAAACCAATTAAGTGCCGTATGATGGCGACGACAAGGAAAAGGC

Full Affymetrix probeset data:

Annotations for 1639609_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime