FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639610_at:

>probe:Drosophila_2:1639610_at:528:295; Interrogation_Position=115; Antisense; CGAAGGCATTATATGGGCCAATTAC
>probe:Drosophila_2:1639610_at:631:29; Interrogation_Position=141; Antisense; ATACTTGGTCAAATGGCTGGATTAT
>probe:Drosophila_2:1639610_at:503:27; Interrogation_Position=179; Antisense; ATACCTGGGAATCGGCAGCAGATCT
>probe:Drosophila_2:1639610_at:712:711; Interrogation_Position=18; Antisense; TTCAGATGCCGATGGTGGCGAGACC
>probe:Drosophila_2:1639610_at:381:265; Interrogation_Position=197; Antisense; CAGATCTCGATTGCCATTCACTTAT
>probe:Drosophila_2:1639610_at:261:315; Interrogation_Position=209; Antisense; GCCATTCACTTATTGATTCGATTGA
>probe:Drosophila_2:1639610_at:247:387; Interrogation_Position=300; Antisense; GAAAATCGATCCATGTCTAGTAGTA
>probe:Drosophila_2:1639610_at:334:499; Interrogation_Position=329; Antisense; GTCCTTTTAATCATGGTTTCACTGC
>probe:Drosophila_2:1639610_at:574:539; Interrogation_Position=343; Antisense; GGTTTCACTGCACAAGAGATTCTAA
>probe:Drosophila_2:1639610_at:164:325; Interrogation_Position=35; Antisense; GCGAGACCGTTTCGAATTTCTCTGA
>probe:Drosophila_2:1639610_at:94:655; Interrogation_Position=401; Antisense; TAATTAGGTTTTGGCATCTCGATCA
>probe:Drosophila_2:1639610_at:345:569; Interrogation_Position=413; Antisense; GGCATCTCGATCAACCACAAGTGGT
>probe:Drosophila_2:1639610_at:273:221; Interrogation_Position=431; Antisense; AAGTGGTGCCAAGTGGAATTGCATA
>probe:Drosophila_2:1639610_at:331:519; Interrogation_Position=457; Antisense; GTGGAAATACCGCAGATGGTTCTGA

Paste this into a BLAST search page for me
CGAAGGCATTATATGGGCCAATTACATACTTGGTCAAATGGCTGGATTATATACCTGGGAATCGGCAGCAGATCTTTCAGATGCCGATGGTGGCGAGACCCAGATCTCGATTGCCATTCACTTATGCCATTCACTTATTGATTCGATTGAGAAAATCGATCCATGTCTAGTAGTAGTCCTTTTAATCATGGTTTCACTGCGGTTTCACTGCACAAGAGATTCTAAGCGAGACCGTTTCGAATTTCTCTGATAATTAGGTTTTGGCATCTCGATCAGGCATCTCGATCAACCACAAGTGGTAAGTGGTGCCAAGTGGAATTGCATAGTGGAAATACCGCAGATGGTTCTGA

Full Affymetrix probeset data:

Annotations for 1639610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720