FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639613_at:

>probe:Drosophila_2:1639613_at:662:417; Interrogation_Position=4833; Antisense; GAGCGGGACACGGACTATGATCTGA
>probe:Drosophila_2:1639613_at:400:147; Interrogation_Position=4846; Antisense; ACTATGATCTGAATGTCCTGCGCAC
>probe:Drosophila_2:1639613_at:160:335; Interrogation_Position=4892; Antisense; GCTGTACAAAGATCCTCATGCGTTA
>probe:Drosophila_2:1639613_at:524:595; Interrogation_Position=4997; Antisense; TGTGGGCGCCACAACCGTGGACGAT
>probe:Drosophila_2:1639613_at:37:139; Interrogation_Position=5017; Antisense; ACGATGTGCGGCATTACGCGTACGA
>probe:Drosophila_2:1639613_at:21:489; Interrogation_Position=5036; Antisense; GTACGAAGGTGACGGCAACTCCGAT
>probe:Drosophila_2:1639613_at:390:135; Interrogation_Position=5092; Antisense; ACGACGGCGATCTCAACTTCGACTA
>probe:Drosophila_2:1639613_at:284:715; Interrogation_Position=5109; Antisense; TTCGACTACCTGTCCAACTTTGGAC
>probe:Drosophila_2:1639613_at:383:343; Interrogation_Position=5137; Antisense; GCTTCCGCAAATTGGCCGACATGTA
>probe:Drosophila_2:1639613_at:319:105; Interrogation_Position=5177; Antisense; AGACACAGACTCCAACGTGGACGAT
>probe:Drosophila_2:1639613_at:46:81; Interrogation_Position=5206; Antisense; AGGGCTGGCGCATCTAGGAATCTTC
>probe:Drosophila_2:1639613_at:40:635; Interrogation_Position=5229; Antisense; TCGCCAGCCGCGGTATGATGACGTA
>probe:Drosophila_2:1639613_at:64:315; Interrogation_Position=5321; Antisense; GCCTAGCCGGCGTCCAAAGTCGATT
>probe:Drosophila_2:1639613_at:298:501; Interrogation_Position=5339; Antisense; GTCGATTCAGAGATATATACCCATA

Paste this into a BLAST search page for me
GAGCGGGACACGGACTATGATCTGAACTATGATCTGAATGTCCTGCGCACGCTGTACAAAGATCCTCATGCGTTATGTGGGCGCCACAACCGTGGACGATACGATGTGCGGCATTACGCGTACGAGTACGAAGGTGACGGCAACTCCGATACGACGGCGATCTCAACTTCGACTATTCGACTACCTGTCCAACTTTGGACGCTTCCGCAAATTGGCCGACATGTAAGACACAGACTCCAACGTGGACGATAGGGCTGGCGCATCTAGGAATCTTCTCGCCAGCCGCGGTATGATGACGTAGCCTAGCCGGCGTCCAAAGTCGATTGTCGATTCAGAGATATATACCCATA

Full Affymetrix probeset data:

Annotations for 1639613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720