Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639620_at:

>probe:Drosophila_2:1639620_at:258:225; Interrogation_Position=1344; Antisense; AAGGAGTTTTGCTCTCTAGCCATGA
>probe:Drosophila_2:1639620_at:167:55; Interrogation_Position=1365; Antisense; ATGACCATTACCAACGGCCTGCTTA
>probe:Drosophila_2:1639620_at:296:705; Interrogation_Position=1387; Antisense; TTATGCCGGCCCAGGTGACCAGAAA
>probe:Drosophila_2:1639620_at:158:107; Interrogation_Position=1407; Antisense; AGAAAGCTGTGCTCCAATGTGGACA
>probe:Drosophila_2:1639620_at:654:525; Interrogation_Position=1447; Antisense; GGGACCCAAGATACGCTCGATTCGC
>probe:Drosophila_2:1639620_at:2:331; Interrogation_Position=1470; Antisense; GCGGAGCTGCGATTTGAGCCTTTCA
>probe:Drosophila_2:1639620_at:505:415; Interrogation_Position=1485; Antisense; GAGCCTTTCATAGCCGCCTTTAGAA
>probe:Drosophila_2:1639620_at:145:697; Interrogation_Position=1517; Antisense; TTTCAACAATGCGAACCTGGCTCTG
>probe:Drosophila_2:1639620_at:562:131; Interrogation_Position=1531; Antisense; ACCTGGCTCTGCTGTTCAAATTGGA
>probe:Drosophila_2:1639620_at:702:725; Interrogation_Position=1594; Antisense; TTGAGCCACCAAAGCAGACAGATTT
>probe:Drosophila_2:1639620_at:333:525; Interrogation_Position=1705; Antisense; GGGAGACAATCCACTTGGCCAATAT
>probe:Drosophila_2:1639620_at:601:135; Interrogation_Position=1747; Antisense; ACGACGCGCAGACCAACATTAGTTA
>probe:Drosophila_2:1639620_at:121:361; Interrogation_Position=1790; Antisense; GAATCAAACCTACAACTGTCGGCAA
>probe:Drosophila_2:1639620_at:726:571; Interrogation_Position=1829; Antisense; GGCTAAGAACATATACTCACCGATT

Paste this into a BLAST search page for me
AAGGAGTTTTGCTCTCTAGCCATGAATGACCATTACCAACGGCCTGCTTATTATGCCGGCCCAGGTGACCAGAAAAGAAAGCTGTGCTCCAATGTGGACAGGGACCCAAGATACGCTCGATTCGCGCGGAGCTGCGATTTGAGCCTTTCAGAGCCTTTCATAGCCGCCTTTAGAATTTCAACAATGCGAACCTGGCTCTGACCTGGCTCTGCTGTTCAAATTGGATTGAGCCACCAAAGCAGACAGATTTGGGAGACAATCCACTTGGCCAATATACGACGCGCAGACCAACATTAGTTAGAATCAAACCTACAACTGTCGGCAAGGCTAAGAACATATACTCACCGATT

Full Affymetrix probeset data:

Annotations for 1639620_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime