FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639621_at:

>probe:Drosophila_2:1639621_at:392:637; Interrogation_Position=435; Antisense; TCGATGACACCGAATTGCCCAAGGT
>probe:Drosophila_2:1639621_at:271:399; Interrogation_Position=488; Antisense; GACAGAGACAGCTTACCGGATGCCC
>probe:Drosophila_2:1639621_at:527:71; Interrogation_Position=549; Antisense; ACGAAGACGGACTGCCCACGTATGT
>probe:Drosophila_2:1639621_at:215:543; Interrogation_Position=581; Antisense; GGATATTACCACGACGATCTCCTGC
>probe:Drosophila_2:1639621_at:251:283; Interrogation_Position=602; Antisense; CTGCCTGCTCCTTATGTACCGGAAA
>probe:Drosophila_2:1639621_at:89:111; Interrogation_Position=627; Antisense; AGAAGGCTGCCTTCGGTTCGCACAG
>probe:Drosophila_2:1639621_at:694:671; Interrogation_Position=655; Antisense; TAGCGCCCGAACTCTGACCGATGAT
>probe:Drosophila_2:1639621_at:481:97; Interrogation_Position=684; Antisense; AGATCCTGGTGCTCAACGACTGTGA
>probe:Drosophila_2:1639621_at:442:595; Interrogation_Position=704; Antisense; TGTGACTACAAGTGGGTGCCCGGAC
>probe:Drosophila_2:1639621_at:607:23; Interrogation_Position=739; Antisense; ATATCCGCGGGATGCTCTGAACACG
>probe:Drosophila_2:1639621_at:270:613; Interrogation_Position=756; Antisense; TGAACACGGGCTACTCCGAGCTGGG
>probe:Drosophila_2:1639621_at:230:621; Interrogation_Position=799; Antisense; TCGTGGTCTTTACCAGGGTATCCTG
>probe:Drosophila_2:1639621_at:532:489; Interrogation_Position=859; Antisense; GTACATCCCGCATCATGGTCAAGAG
>probe:Drosophila_2:1639621_at:178:329; Interrogation_Position=888; Antisense; GCGTAAACACCTACGAAGTCCTGGT

Paste this into a BLAST search page for me
TCGATGACACCGAATTGCCCAAGGTGACAGAGACAGCTTACCGGATGCCCACGAAGACGGACTGCCCACGTATGTGGATATTACCACGACGATCTCCTGCCTGCCTGCTCCTTATGTACCGGAAAAGAAGGCTGCCTTCGGTTCGCACAGTAGCGCCCGAACTCTGACCGATGATAGATCCTGGTGCTCAACGACTGTGATGTGACTACAAGTGGGTGCCCGGACATATCCGCGGGATGCTCTGAACACGTGAACACGGGCTACTCCGAGCTGGGTCGTGGTCTTTACCAGGGTATCCTGGTACATCCCGCATCATGGTCAAGAGGCGTAAACACCTACGAAGTCCTGGT

Full Affymetrix probeset data:

Annotations for 1639621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720