FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639622_at:

>probe:Drosophila_2:1639622_at:269:665; Interrogation_Position=200; Antisense; TAGGACGGAATACTTAGCCACCCAC
>probe:Drosophila_2:1639622_at:36:157; Interrogation_Position=237; Antisense; AACTCCGTAACTTGAAACTCCATCG
>probe:Drosophila_2:1639622_at:353:87; Interrogation_Position=310; Antisense; AGTGCCACGGAGTCACGGAACTGGA
>probe:Drosophila_2:1639622_at:724:153; Interrogation_Position=354; Antisense; ACAGGTGGCTCTTGGTTTGGATGAC
>probe:Drosophila_2:1639622_at:593:729; Interrogation_Position=370; Antisense; TTGGATGACGGTGCTGCTCCTGGTC
>probe:Drosophila_2:1639622_at:541:475; Interrogation_Position=420; Antisense; GTTACCTGCCGACAAGGTCGCATGG
>probe:Drosophila_2:1639622_at:296:469; Interrogation_Position=460; Antisense; GTTGCGTGAACTGATGCTGCAGATT
>probe:Drosophila_2:1639622_at:38:423; Interrogation_Position=493; Antisense; GAGCAATGAGGACCCACAACAGCAG
>probe:Drosophila_2:1639622_at:527:119; Interrogation_Position=549; Antisense; AGCTGCGTCTCCACAATGAGGCCAC
>probe:Drosophila_2:1639622_at:345:359; Interrogation_Position=594; Antisense; GCAACATCAACAATCCACGCGTGTC
>probe:Drosophila_2:1639622_at:679:133; Interrogation_Position=610; Antisense; ACGCGTGTCCAACGGCAACTCTAAT
>probe:Drosophila_2:1639622_at:327:469; Interrogation_Position=700; Antisense; GTTCGGGCCCAACTATGGGCGTTAT
>probe:Drosophila_2:1639622_at:62:661; Interrogation_Position=725; Antisense; TAAGCCATCTGGGAACACCTGACGA
>probe:Drosophila_2:1639622_at:653:125; Interrogation_Position=754; Antisense; AGCCACCACGACTATGGACACGGAA

Paste this into a BLAST search page for me
TAGGACGGAATACTTAGCCACCCACAACTCCGTAACTTGAAACTCCATCGAGTGCCACGGAGTCACGGAACTGGAACAGGTGGCTCTTGGTTTGGATGACTTGGATGACGGTGCTGCTCCTGGTCGTTACCTGCCGACAAGGTCGCATGGGTTGCGTGAACTGATGCTGCAGATTGAGCAATGAGGACCCACAACAGCAGAGCTGCGTCTCCACAATGAGGCCACGCAACATCAACAATCCACGCGTGTCACGCGTGTCCAACGGCAACTCTAATGTTCGGGCCCAACTATGGGCGTTATTAAGCCATCTGGGAACACCTGACGAAGCCACCACGACTATGGACACGGAA

Full Affymetrix probeset data:

Annotations for 1639622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720