FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639623_at:

>probe:Drosophila_2:1639623_at:205:401; Interrogation_Position=103; Antisense; GACATGTTTGATGCGGATGCTCCTT
>probe:Drosophila_2:1639623_at:653:291; Interrogation_Position=226; Antisense; CGTCAATCCAATCCATCGAGCAATA
>probe:Drosophila_2:1639623_at:435:51; Interrogation_Position=269; Antisense; ATGCGAATGTCTACTGTGGTCAGAA
>probe:Drosophila_2:1639623_at:558:109; Interrogation_Position=299; Antisense; AGCAACTAGGGCCAATTACCAGCGG
>probe:Drosophila_2:1639623_at:479:693; Interrogation_Position=314; Antisense; TTACCAGCGGCAACCAAACGTCAAA
>probe:Drosophila_2:1639623_at:680:161; Interrogation_Position=336; Antisense; AAATTGTCCCACATTGAACGCAAAT
>probe:Drosophila_2:1639623_at:98:233; Interrogation_Position=376; Antisense; AATGCAAATGCGAACCCGAATCCGA
>probe:Drosophila_2:1639623_at:443:33; Interrogation_Position=407; Antisense; ATCTGAACCCGAATCCGAGTAGCCA
>probe:Drosophila_2:1639623_at:541:631; Interrogation_Position=420; Antisense; TCCGAGTAGCCACAACACCAATAGT
>probe:Drosophila_2:1639623_at:90:679; Interrogation_Position=441; Antisense; TAGTCACTCCAGTAGCCAAGCGAAT
>probe:Drosophila_2:1639623_at:230:129; Interrogation_Position=490; Antisense; ACCACCAACAATATCACAGCAGCAA
>probe:Drosophila_2:1639623_at:610:239; Interrogation_Position=592; Antisense; AATCAAAACATTTCCTCCAGCTTAG
>probe:Drosophila_2:1639623_at:204:657; Interrogation_Position=620; Antisense; TAATCCTTTCGCCAATTATCCAAAG
>probe:Drosophila_2:1639623_at:540:151; Interrogation_Position=71; Antisense; ACACCGAAGACGATGAGGCCGCCGA

Paste this into a BLAST search page for me
GACATGTTTGATGCGGATGCTCCTTCGTCAATCCAATCCATCGAGCAATAATGCGAATGTCTACTGTGGTCAGAAAGCAACTAGGGCCAATTACCAGCGGTTACCAGCGGCAACCAAACGTCAAAAAATTGTCCCACATTGAACGCAAATAATGCAAATGCGAACCCGAATCCGAATCTGAACCCGAATCCGAGTAGCCATCCGAGTAGCCACAACACCAATAGTTAGTCACTCCAGTAGCCAAGCGAATACCACCAACAATATCACAGCAGCAAAATCAAAACATTTCCTCCAGCTTAGTAATCCTTTCGCCAATTATCCAAAGACACCGAAGACGATGAGGCCGCCGA

Full Affymetrix probeset data:

Annotations for 1639623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720