FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639624_at:

>probe:Drosophila_2:1639624_at:682:563; Interrogation_Position=1014; Antisense; GGAATCCGGAACGAACAGCAGCCAC
>probe:Drosophila_2:1639624_at:73:475; Interrogation_Position=1081; Antisense; GTTAGCCCGGGCATCAATGAATCTT
>probe:Drosophila_2:1639624_at:534:53; Interrogation_Position=1097; Antisense; ATGAATCTTCCGGATTGCAACCCGT
>probe:Drosophila_2:1639624_at:611:253; Interrogation_Position=1142; Antisense; CAAGCCAAGATTTGCCCCAGCAGGT
>probe:Drosophila_2:1639624_at:130:339; Interrogation_Position=1161; Antisense; GCAGGTTGTCCAAACTAAGCCGGCC
>probe:Drosophila_2:1639624_at:403:107; Interrogation_Position=1250; Antisense; AGAACTGCTGCTACAAATCCGCTTT
>probe:Drosophila_2:1639624_at:606:399; Interrogation_Position=704; Antisense; GACAGGACACCTGGCGAAAGCGCAG
>probe:Drosophila_2:1639624_at:465:85; Interrogation_Position=732; Antisense; AGTGCTGCCAACGAACAAGTTCCTA
>probe:Drosophila_2:1639624_at:591:127; Interrogation_Position=757; Antisense; ACCAAGTTGCTTGAGGGCTGCGCCT
>probe:Drosophila_2:1639624_at:122:83; Interrogation_Position=770; Antisense; AGGGCTGCGCCTACTCGACGGATAA
>probe:Drosophila_2:1639624_at:539:407; Interrogation_Position=786; Antisense; GACGGATAACCTCAGTCCCTCGAAT
>probe:Drosophila_2:1639624_at:442:619; Interrogation_Position=821; Antisense; TGCTGCGGACTAATACCACGGACGT
>probe:Drosophila_2:1639624_at:11:75; Interrogation_Position=907; Antisense; AGGACAACAATGCATGCCACGCTTG
>probe:Drosophila_2:1639624_at:557:347; Interrogation_Position=945; Antisense; GCATCCTTCACTCTCGACGAATGAT

Paste this into a BLAST search page for me
GGAATCCGGAACGAACAGCAGCCACGTTAGCCCGGGCATCAATGAATCTTATGAATCTTCCGGATTGCAACCCGTCAAGCCAAGATTTGCCCCAGCAGGTGCAGGTTGTCCAAACTAAGCCGGCCAGAACTGCTGCTACAAATCCGCTTTGACAGGACACCTGGCGAAAGCGCAGAGTGCTGCCAACGAACAAGTTCCTAACCAAGTTGCTTGAGGGCTGCGCCTAGGGCTGCGCCTACTCGACGGATAAGACGGATAACCTCAGTCCCTCGAATTGCTGCGGACTAATACCACGGACGTAGGACAACAATGCATGCCACGCTTGGCATCCTTCACTCTCGACGAATGAT

Full Affymetrix probeset data:

Annotations for 1639624_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720