Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639626_at:

>probe:Drosophila_2:1639626_at:309:187; Interrogation_Position=2609; Antisense; AACACAGCACAGCAGACGGAGCAGC
>probe:Drosophila_2:1639626_at:461:437; Interrogation_Position=2648; Antisense; GAGGAGACGCACAAGGACGCCCAGT
>probe:Drosophila_2:1639626_at:473:555; Interrogation_Position=2662; Antisense; GGACGCCCAGTCCAAAGTACAATCG
>probe:Drosophila_2:1639626_at:299:665; Interrogation_Position=2679; Antisense; TACAATCGTAGGCAGCGTTCGCGCT
>probe:Drosophila_2:1639626_at:601:553; Interrogation_Position=2723; Antisense; GGAGCGGAAGCGACGTTCCCACAGT
>probe:Drosophila_2:1639626_at:708:235; Interrogation_Position=2841; Antisense; AATCGCGAGCGGGAACAGTACAGGC
>probe:Drosophila_2:1639626_at:328:69; Interrogation_Position=2932; Antisense; ATGGCGGCAGTGGTTCTTCGAATCG
>probe:Drosophila_2:1639626_at:627:273; Interrogation_Position=2947; Antisense; CTTCGAATCGAGGACGCGTCGTCAT
>probe:Drosophila_2:1639626_at:576:319; Interrogation_Position=2976; Antisense; GCCCCGCCAAAGCTCAAGAAACTGG
>probe:Drosophila_2:1639626_at:551:403; Interrogation_Position=3003; Antisense; GACTATTGATCCCAAAACCGTTGTG
>probe:Drosophila_2:1639626_at:75:375; Interrogation_Position=3030; Antisense; GAAGACGTTTTTCTATTCACTTGAT
>probe:Drosophila_2:1639626_at:163:687; Interrogation_Position=3055; Antisense; TATACATTTGATATTCGCTCGATTG
>probe:Drosophila_2:1639626_at:404:461; Interrogation_Position=3097; Antisense; GATTTATTTCTGGAGCGTGTTTTGC
>probe:Drosophila_2:1639626_at:255:477; Interrogation_Position=3115; Antisense; GTTTTGCGCTCACTGTTGATTCTGC

Paste this into a BLAST search page for me
AACACAGCACAGCAGACGGAGCAGCGAGGAGACGCACAAGGACGCCCAGTGGACGCCCAGTCCAAAGTACAATCGTACAATCGTAGGCAGCGTTCGCGCTGGAGCGGAAGCGACGTTCCCACAGTAATCGCGAGCGGGAACAGTACAGGCATGGCGGCAGTGGTTCTTCGAATCGCTTCGAATCGAGGACGCGTCGTCATGCCCCGCCAAAGCTCAAGAAACTGGGACTATTGATCCCAAAACCGTTGTGGAAGACGTTTTTCTATTCACTTGATTATACATTTGATATTCGCTCGATTGGATTTATTTCTGGAGCGTGTTTTGCGTTTTGCGCTCACTGTTGATTCTGC

Full Affymetrix probeset data:

Annotations for 1639626_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime