FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639627_at:

>probe:Drosophila_2:1639627_at:87:151; Interrogation_Position=1004; Antisense; ACTTGCGATCGTCCCTGATGAAAAA
>probe:Drosophila_2:1639627_at:158:393; Interrogation_Position=1044; Antisense; GAAAGTCTATGCTACGCGAGTTAAT
>probe:Drosophila_2:1639627_at:107:451; Interrogation_Position=520; Antisense; GATCTGTTATCCTTTTTACCTGTTG
>probe:Drosophila_2:1639627_at:182:441; Interrogation_Position=621; Antisense; GATGGAGTGTCGATCCTTGGATCCA
>probe:Drosophila_2:1639627_at:37:449; Interrogation_Position=640; Antisense; GATCCATCGTTCACCTACTTTAAGA
>probe:Drosophila_2:1639627_at:511:501; Interrogation_Position=692; Antisense; GTCGAGCTGCTCTCTATGTTAGTGA
>probe:Drosophila_2:1639627_at:512:435; Interrogation_Position=715; Antisense; GAGGTGTTTCTCTACAAAGATCCAA
>probe:Drosophila_2:1639627_at:586:457; Interrogation_Position=745; Antisense; GATATCGTTCTTAACCTTGGTGTTT
>probe:Drosophila_2:1639627_at:712:165; Interrogation_Position=783; Antisense; AAATCGTCGTTTTCAGTTCCTGAAT
>probe:Drosophila_2:1639627_at:310:445; Interrogation_Position=870; Antisense; GATGACTCCACTGTTGAGAATCTCA
>probe:Drosophila_2:1639627_at:616:367; Interrogation_Position=900; Antisense; GAATGCTACATGTCCGCTTCAGCAA
>probe:Drosophila_2:1639627_at:54:21; Interrogation_Position=926; Antisense; ATATAACTTTCAACGGCTTTTCTGT
>probe:Drosophila_2:1639627_at:63:429; Interrogation_Position=970; Antisense; GAGATTCCAATTCCAAACGGTGTTT
>probe:Drosophila_2:1639627_at:506:533; Interrogation_Position=988; Antisense; GGTGTTTACATGTTCCACTTGCGAT

Paste this into a BLAST search page for me
ACTTGCGATCGTCCCTGATGAAAAAGAAAGTCTATGCTACGCGAGTTAATGATCTGTTATCCTTTTTACCTGTTGGATGGAGTGTCGATCCTTGGATCCAGATCCATCGTTCACCTACTTTAAGAGTCGAGCTGCTCTCTATGTTAGTGAGAGGTGTTTCTCTACAAAGATCCAAGATATCGTTCTTAACCTTGGTGTTTAAATCGTCGTTTTCAGTTCCTGAATGATGACTCCACTGTTGAGAATCTCAGAATGCTACATGTCCGCTTCAGCAAATATAACTTTCAACGGCTTTTCTGTGAGATTCCAATTCCAAACGGTGTTTGGTGTTTACATGTTCCACTTGCGAT

Full Affymetrix probeset data:

Annotations for 1639627_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720