FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639628_at:

>probe:Drosophila_2:1639628_at:560:517; Interrogation_Position=123; Antisense; GTGGATGGGCAATCAGTCTACGATG
>probe:Drosophila_2:1639628_at:341:493; Interrogation_Position=138; Antisense; GTCTACGATGACTAAGGGTTTGCCA
>probe:Drosophila_2:1639628_at:346:531; Interrogation_Position=153; Antisense; GGGTTTGCCATCCAATACAGTGAAT
>probe:Drosophila_2:1639628_at:571:625; Interrogation_Position=183; Antisense; TGCCCAGACGGCATCTGTCAATGAT
>probe:Drosophila_2:1639628_at:189:567; Interrogation_Position=208; Antisense; GGCAACTTGCAAGCTAGCGTGATCG
>probe:Drosophila_2:1639628_at:241:675; Interrogation_Position=222; Antisense; TAGCGTGATCGCAATGCTGGCAGGA
>probe:Drosophila_2:1639628_at:8:623; Interrogation_Position=236; Antisense; TGCTGGCAGGAATGGACTCGATCTT
>probe:Drosophila_2:1639628_at:142:637; Interrogation_Position=253; Antisense; TCGATCTTGGACATGGAGCAGCCTA
>probe:Drosophila_2:1639628_at:323:421; Interrogation_Position=268; Antisense; GAGCAGCCTAACAGAAGTCCTTCGC
>probe:Drosophila_2:1639628_at:279:87; Interrogation_Position=283; Antisense; AGTCCTTCGCGCGAAGAGCACGAGC
>probe:Drosophila_2:1639628_at:79:421; Interrogation_Position=298; Antisense; GAGCACGAGCGCCTAAATGAGCTGT
>probe:Drosophila_2:1639628_at:159:159; Interrogation_Position=47; Antisense; ACAACGAATCCCATTCCTATTTCCT
>probe:Drosophila_2:1639628_at:368:9; Interrogation_Position=79; Antisense; ATTCCGGAAGAATTGCAGCCTCAGT
>probe:Drosophila_2:1639628_at:582:617; Interrogation_Position=92; Antisense; TGCAGCCTCAGTTTACGCGTGGATT

Paste this into a BLAST search page for me
GTGGATGGGCAATCAGTCTACGATGGTCTACGATGACTAAGGGTTTGCCAGGGTTTGCCATCCAATACAGTGAATTGCCCAGACGGCATCTGTCAATGATGGCAACTTGCAAGCTAGCGTGATCGTAGCGTGATCGCAATGCTGGCAGGATGCTGGCAGGAATGGACTCGATCTTTCGATCTTGGACATGGAGCAGCCTAGAGCAGCCTAACAGAAGTCCTTCGCAGTCCTTCGCGCGAAGAGCACGAGCGAGCACGAGCGCCTAAATGAGCTGTACAACGAATCCCATTCCTATTTCCTATTCCGGAAGAATTGCAGCCTCAGTTGCAGCCTCAGTTTACGCGTGGATT

Full Affymetrix probeset data:

Annotations for 1639628_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720