FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639629_at:

>probe:Drosophila_2:1639629_at:220:409; Interrogation_Position=263; Antisense; GACGTCACGATTGGCATGGACTTCA
>probe:Drosophila_2:1639629_at:148:105; Interrogation_Position=316; Antisense; AGACTACAAGGTGGCCCTGTGGGAT
>probe:Drosophila_2:1639629_at:345:283; Interrogation_Position=368; Antisense; CTGACGCCCAGTTTCTATCGGAAGG
>probe:Drosophila_2:1639629_at:343:595; Interrogation_Position=396; Antisense; TGGGCGCCATTCTAGTGTACGACAT
>probe:Drosophila_2:1639629_at:80:515; Interrogation_Position=410; Antisense; GTGTACGACATCACCAGCAGGGACA
>probe:Drosophila_2:1639629_at:295:561; Interrogation_Position=448; Antisense; GGAAACCTGGCTGGCTGAACTGGAT
>probe:Drosophila_2:1639629_at:296:27; Interrogation_Position=471; Antisense; ATAGCTACAGCGACAATCCCAACAT
>probe:Drosophila_2:1639629_at:709:209; Interrogation_Position=572; Antisense; AAGCACAGGGCGCTCTTCATCGAGA
>probe:Drosophila_2:1639629_at:647:291; Interrogation_Position=592; Antisense; CGAGACCTCAGCCAAATGCGATCAG
>probe:Drosophila_2:1639629_at:643:453; Interrogation_Position=611; Antisense; GATCAGTTCGTCAGCGATGTGTTCA
>probe:Drosophila_2:1639629_at:505:109; Interrogation_Position=648; Antisense; AGAAGATCGTCTCCTCCGAATACTT
>probe:Drosophila_2:1639629_at:610:151; Interrogation_Position=702; Antisense; ACATCGCCAGCGATCGGGATCTGGA
>probe:Drosophila_2:1639629_at:523:123; Interrogation_Position=731; Antisense; AGCGCGTCTACGTGTTACTGTTGAT
>probe:Drosophila_2:1639629_at:68:461; Interrogation_Position=753; Antisense; GATTTCGAATGTTATGCGTGCTTTT

Paste this into a BLAST search page for me
GACGTCACGATTGGCATGGACTTCAAGACTACAAGGTGGCCCTGTGGGATCTGACGCCCAGTTTCTATCGGAAGGTGGGCGCCATTCTAGTGTACGACATGTGTACGACATCACCAGCAGGGACAGGAAACCTGGCTGGCTGAACTGGATATAGCTACAGCGACAATCCCAACATAAGCACAGGGCGCTCTTCATCGAGACGAGACCTCAGCCAAATGCGATCAGGATCAGTTCGTCAGCGATGTGTTCAAGAAGATCGTCTCCTCCGAATACTTACATCGCCAGCGATCGGGATCTGGAAGCGCGTCTACGTGTTACTGTTGATGATTTCGAATGTTATGCGTGCTTTT

Full Affymetrix probeset data:

Annotations for 1639629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720