FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639630_at:

>probe:Drosophila_2:1639630_at:173:349; Interrogation_Position=102; Antisense; GCAGGCCACCGTCATAAGTACTGAA
>probe:Drosophila_2:1639630_at:620:217; Interrogation_Position=117; Antisense; AAGTACTGAACTCGGATCTACCACC
>probe:Drosophila_2:1639630_at:255:545; Interrogation_Position=130; Antisense; GGATCTACCACCTGTGAAGCGTGTA
>probe:Drosophila_2:1639630_at:695:513; Interrogation_Position=177; Antisense; GTGTTCCGATATACGTACTCCGATG
>probe:Drosophila_2:1639630_at:603:591; Interrogation_Position=21; Antisense; TGGGAACAGCAAGCCGCAAACGGTG
>probe:Drosophila_2:1639630_at:552:63; Interrogation_Position=218; Antisense; ATGTGAGTGCCTTACATCCAGTTCC
>probe:Drosophila_2:1639630_at:560:469; Interrogation_Position=238; Antisense; GTTCCGGTGGCCAAGTCCTGGAAGA
>probe:Drosophila_2:1639630_at:654:383; Interrogation_Position=319; Antisense; GAACTATTCGGTACGCCTGTAAAAT
>probe:Drosophila_2:1639630_at:316:563; Interrogation_Position=381; Antisense; GGAAGAGCTGGTTCACTGCTATCAA
>probe:Drosophila_2:1639630_at:562:255; Interrogation_Position=394; Antisense; CACTGCTATCAACGGTTTCCAAACG
>probe:Drosophila_2:1639630_at:43:381; Interrogation_Position=418; Antisense; GAACCCCTTCAGTGCTCTAATTTGG
>probe:Drosophila_2:1639630_at:412:653; Interrogation_Position=435; Antisense; TAATTTGGCCAGACAGTATCACCGA
>probe:Drosophila_2:1639630_at:371:483; Interrogation_Position=450; Antisense; GTATCACCGATTCGTATTCGCCAAA
>probe:Drosophila_2:1639630_at:490:627; Interrogation_Position=57; Antisense; TCCAACGGCATTTGAGATTACTCGG

Paste this into a BLAST search page for me
GCAGGCCACCGTCATAAGTACTGAAAAGTACTGAACTCGGATCTACCACCGGATCTACCACCTGTGAAGCGTGTAGTGTTCCGATATACGTACTCCGATGTGGGAACAGCAAGCCGCAAACGGTGATGTGAGTGCCTTACATCCAGTTCCGTTCCGGTGGCCAAGTCCTGGAAGAGAACTATTCGGTACGCCTGTAAAATGGAAGAGCTGGTTCACTGCTATCAACACTGCTATCAACGGTTTCCAAACGGAACCCCTTCAGTGCTCTAATTTGGTAATTTGGCCAGACAGTATCACCGAGTATCACCGATTCGTATTCGCCAAATCCAACGGCATTTGAGATTACTCGG

Full Affymetrix probeset data:

Annotations for 1639630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720