FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639632_at:

>probe:Drosophila_2:1639632_at:121:373; Interrogation_Position=2048; Antisense; GAAGTCTGCATCTGCTCCATAATGG
>probe:Drosophila_2:1639632_at:495:29; Interrogation_Position=2095; Antisense; ATAAAACAAACCTTCCAGCTCACTT
>probe:Drosophila_2:1639632_at:118:651; Interrogation_Position=2114; Antisense; TCACTTCTGTGCTTGACAACCTATT
>probe:Drosophila_2:1639632_at:302:399; Interrogation_Position=2146; Antisense; GACACTACGATAGGCTCTGGTCGTT
>probe:Drosophila_2:1639632_at:105:589; Interrogation_Position=2163; Antisense; TGGTCGTTACGATCCCGAACTGGAC
>probe:Drosophila_2:1639632_at:154:557; Interrogation_Position=2184; Antisense; GGACGATCCTGAGTACTGTAACGCA
>probe:Drosophila_2:1639632_at:76:333; Interrogation_Position=2220; Antisense; GCTGTATGAGCTTGCGCTTCTGGCA
>probe:Drosophila_2:1639632_at:252:69; Interrogation_Position=2272; Antisense; ATGGCCGTTCACATTGCTCATGGAG
>probe:Drosophila_2:1639632_at:124:295; Interrogation_Position=2310; Antisense; CGAGGGAGCTTTGCCCACGGAAATT
>probe:Drosophila_2:1639632_at:715:389; Interrogation_Position=2329; Antisense; GAAATTGGCAAACTTACCTCCCACG
>probe:Drosophila_2:1639632_at:529:707; Interrogation_Position=2360; Antisense; TTACGCAATTCGACAGCACTCAGAT
>probe:Drosophila_2:1639632_at:674:353; Interrogation_Position=2375; Antisense; GCACTCAGATGGCTTTCAATCCGAC
>probe:Drosophila_2:1639632_at:490:235; Interrogation_Position=2392; Antisense; AATCCGACAATACCGCTGCCAAAAG
>probe:Drosophila_2:1639632_at:248:21; Interrogation_Position=2453; Antisense; ATATTCGCTCGGACTTCAAACAGGA

Paste this into a BLAST search page for me
GAAGTCTGCATCTGCTCCATAATGGATAAAACAAACCTTCCAGCTCACTTTCACTTCTGTGCTTGACAACCTATTGACACTACGATAGGCTCTGGTCGTTTGGTCGTTACGATCCCGAACTGGACGGACGATCCTGAGTACTGTAACGCAGCTGTATGAGCTTGCGCTTCTGGCAATGGCCGTTCACATTGCTCATGGAGCGAGGGAGCTTTGCCCACGGAAATTGAAATTGGCAAACTTACCTCCCACGTTACGCAATTCGACAGCACTCAGATGCACTCAGATGGCTTTCAATCCGACAATCCGACAATACCGCTGCCAAAAGATATTCGCTCGGACTTCAAACAGGA

Full Affymetrix probeset data:

Annotations for 1639632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720