Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639633_at:

>probe:Drosophila_2:1639633_at:587:595; Interrogation_Position=2213; Antisense; TGTACTACTTTCAGCTGTACAACTT
>probe:Drosophila_2:1639633_at:174:121; Interrogation_Position=2225; Antisense; AGCTGTACAACTTCCGCTAGTCAAT
>probe:Drosophila_2:1639633_at:670:699; Interrogation_Position=2283; Antisense; TTTATTTTTATCTATCGGCCCCCAG
>probe:Drosophila_2:1639633_at:608:113; Interrogation_Position=2306; Antisense; AGCAGCTGGGCTATAGTTGTGAAAG
>probe:Drosophila_2:1639633_at:539:273; Interrogation_Position=2396; Antisense; CTTAAATTTACACTAACCGCGCACG
>probe:Drosophila_2:1639633_at:578:201; Interrogation_Position=2410; Antisense; AACCGCGCACGTTAGATTAGCAAAA
>probe:Drosophila_2:1639633_at:609:461; Interrogation_Position=2424; Antisense; GATTAGCAAAATTACAAGTCTCGAT
>probe:Drosophila_2:1639633_at:211:615; Interrogation_Position=2454; Antisense; TGCAATTAAATTTTCGTACGTAACG
>probe:Drosophila_2:1639633_at:422:489; Interrogation_Position=2469; Antisense; GTACGTAACGTTTGTCCGCATTCAA
>probe:Drosophila_2:1639633_at:224:481; Interrogation_Position=2478; Antisense; GTTTGTCCGCATTCAACTGTGATTT
>probe:Drosophila_2:1639633_at:543:491; Interrogation_Position=2541; Antisense; GTAAATTATGTGATCGGTTGCCAAA
>probe:Drosophila_2:1639633_at:415:495; Interrogation_Position=2713; Antisense; GTCACTGTCACTTCTTATAAGCTTT
>probe:Drosophila_2:1639633_at:632:231; Interrogation_Position=2747; Antisense; AATCGTTAACTGAACTCAACTGACT
>probe:Drosophila_2:1639633_at:492:383; Interrogation_Position=2758; Antisense; GAACTCAACTGACTTAAGTGGTTAA

Paste this into a BLAST search page for me
TGTACTACTTTCAGCTGTACAACTTAGCTGTACAACTTCCGCTAGTCAATTTTATTTTTATCTATCGGCCCCCAGAGCAGCTGGGCTATAGTTGTGAAAGCTTAAATTTACACTAACCGCGCACGAACCGCGCACGTTAGATTAGCAAAAGATTAGCAAAATTACAAGTCTCGATTGCAATTAAATTTTCGTACGTAACGGTACGTAACGTTTGTCCGCATTCAAGTTTGTCCGCATTCAACTGTGATTTGTAAATTATGTGATCGGTTGCCAAAGTCACTGTCACTTCTTATAAGCTTTAATCGTTAACTGAACTCAACTGACTGAACTCAACTGACTTAAGTGGTTAA

Full Affymetrix probeset data:

Annotations for 1639633_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime