FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639634_at:

>probe:Drosophila_2:1639634_at:172:609; Interrogation_Position=1056; Antisense; TGAGCCTCTGAAGCCGCGCAATGAA
>probe:Drosophila_2:1639634_at:410:357; Interrogation_Position=1095; Antisense; GCACACTTTGGATTTGTGGACCCAT
>probe:Drosophila_2:1639634_at:694:411; Interrogation_Position=1113; Antisense; GACCCATTCATGGTGCTTCAACAAT
>probe:Drosophila_2:1639634_at:56:489; Interrogation_Position=621; Antisense; GTACTACAAGCCCAGCAAATCGCTG
>probe:Drosophila_2:1639634_at:332:587; Interrogation_Position=644; Antisense; TGGACCGCGAATTCGACCAGTACTG
>probe:Drosophila_2:1639634_at:610:127; Interrogation_Position=659; Antisense; ACCAGTACTGGGTGGAGTGCTTCTT
>probe:Drosophila_2:1639634_at:453:361; Interrogation_Position=707; Antisense; GCAAGGTTGCTCCTGAGCGCACTTA
>probe:Drosophila_2:1639634_at:585:609; Interrogation_Position=720; Antisense; TGAGCGCACTTACCGCGTGTTAACC
>probe:Drosophila_2:1639634_at:523:253; Interrogation_Position=744; Antisense; CAAAAAGTGCGTTTCCGCTCCGAAG
>probe:Drosophila_2:1639634_at:675:305; Interrogation_Position=827; Antisense; CCTGTCCCAAGATCAAGCTATGCGA
>probe:Drosophila_2:1639634_at:730:205; Interrogation_Position=841; Antisense; AAGCTATGCGAGTGTCCGCCGGCAG
>probe:Drosophila_2:1639634_at:637:305; Interrogation_Position=859; Antisense; CCGGCAGCTGCCATTAACAATTGTA
>probe:Drosophila_2:1639634_at:194:325; Interrogation_Position=891; Antisense; GCGAAGACACACAAGATGCCGGCGT
>probe:Drosophila_2:1639634_at:472:613; Interrogation_Position=962; Antisense; TGAACACCAGCAGACCCATCGAGTG

Paste this into a BLAST search page for me
TGAGCCTCTGAAGCCGCGCAATGAAGCACACTTTGGATTTGTGGACCCATGACCCATTCATGGTGCTTCAACAATGTACTACAAGCCCAGCAAATCGCTGTGGACCGCGAATTCGACCAGTACTGACCAGTACTGGGTGGAGTGCTTCTTGCAAGGTTGCTCCTGAGCGCACTTATGAGCGCACTTACCGCGTGTTAACCCAAAAAGTGCGTTTCCGCTCCGAAGCCTGTCCCAAGATCAAGCTATGCGAAAGCTATGCGAGTGTCCGCCGGCAGCCGGCAGCTGCCATTAACAATTGTAGCGAAGACACACAAGATGCCGGCGTTGAACACCAGCAGACCCATCGAGTG

Full Affymetrix probeset data:

Annotations for 1639634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720