FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639636_at:

>probe:Drosophila_2:1639636_at:577:365; Interrogation_Position=3230; Antisense; GAATCGATGCCCTAGATTTAGTTGT
>probe:Drosophila_2:1639636_at:450:467; Interrogation_Position=3250; Antisense; GTTGTAATGCGAAACTGCCACGAAA
>probe:Drosophila_2:1639636_at:82:179; Interrogation_Position=3261; Antisense; AAACTGCCACGAAACTCTTTTGCTG
>probe:Drosophila_2:1639636_at:241:397; Interrogation_Position=3325; Antisense; GACAACTTGCTAAATTTCGGCTGAA
>probe:Drosophila_2:1639636_at:403:243; Interrogation_Position=3363; Antisense; AATATAGGTCTAGCTAGTGCTGTAA
>probe:Drosophila_2:1639636_at:582:61; Interrogation_Position=3397; Antisense; ATGTCTTAGTTACCAATTCGCACCC
>probe:Drosophila_2:1639636_at:267:247; Interrogation_Position=3411; Antisense; AATTCGCACCCACAACAAAGATGAG
>probe:Drosophila_2:1639636_at:664:191; Interrogation_Position=3461; Antisense; AACTACTTTCTGAGAGGCGCACAAT
>probe:Drosophila_2:1639636_at:15:325; Interrogation_Position=3477; Antisense; GCGCACAATTAACTTTCGCATTTCC
>probe:Drosophila_2:1639636_at:209:719; Interrogation_Position=3491; Antisense; TTCGCATTTCCGTATGACTCGTAAC
>probe:Drosophila_2:1639636_at:256:215; Interrogation_Position=3532; Antisense; AAGATGCCCGAAACTTCCGTATAGC
>probe:Drosophila_2:1639636_at:92:387; Interrogation_Position=3541; Antisense; GAAACTTCCGTATAGCAAACTGTGA
>probe:Drosophila_2:1639636_at:474:395; Interrogation_Position=3590; Antisense; GAAATCGGCCTAAGAAGTCACTATC
>probe:Drosophila_2:1639636_at:56:635; Interrogation_Position=3693; Antisense; TCCCATGTCATTCCCAATCTGAATA

Paste this into a BLAST search page for me
GAATCGATGCCCTAGATTTAGTTGTGTTGTAATGCGAAACTGCCACGAAAAAACTGCCACGAAACTCTTTTGCTGGACAACTTGCTAAATTTCGGCTGAAAATATAGGTCTAGCTAGTGCTGTAAATGTCTTAGTTACCAATTCGCACCCAATTCGCACCCACAACAAAGATGAGAACTACTTTCTGAGAGGCGCACAATGCGCACAATTAACTTTCGCATTTCCTTCGCATTTCCGTATGACTCGTAACAAGATGCCCGAAACTTCCGTATAGCGAAACTTCCGTATAGCAAACTGTGAGAAATCGGCCTAAGAAGTCACTATCTCCCATGTCATTCCCAATCTGAATA

Full Affymetrix probeset data:

Annotations for 1639636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720