Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639638_a_at:

>probe:Drosophila_2:1639638_a_at:123:331; Interrogation_Position=210; Antisense; GCTGTCCATTGAAACCTATACCACG
>probe:Drosophila_2:1639638_a_at:88:405; Interrogation_Position=240; Antisense; GACTAAGCTGAAGATTGCGGCCAAA
>probe:Drosophila_2:1639638_a_at:722:421; Interrogation_Position=284; Antisense; GAGAATATGCCCTTTCTGGCAACAT
>probe:Drosophila_2:1639638_a_at:73:377; Interrogation_Position=346; Antisense; GAAGCAATGGCCTATCGAAGCACCT
>probe:Drosophila_2:1639638_a_at:642:461; Interrogation_Position=393; Antisense; GATTATGCCGTTTAGCATCCCGAAA
>probe:Drosophila_2:1639638_a_at:280:707; Interrogation_Position=404; Antisense; TTAGCATCCCGAAACAGCCATATGT
>probe:Drosophila_2:1639638_a_at:482:485; Interrogation_Position=457; Antisense; GTAGTGCTACCAAATCTGGGCGATT
>probe:Drosophila_2:1639638_a_at:558:465; Interrogation_Position=478; Antisense; GATTGTTCCAATCTCATCAAGTTTG
>probe:Drosophila_2:1639638_a_at:152:441; Interrogation_Position=502; Antisense; GATGGCAAATTCGAGCCACCGTGGC
>probe:Drosophila_2:1639638_a_at:153:517; Interrogation_Position=522; Antisense; GTGGCCCCAGGATACGTACGTGTTG
>probe:Drosophila_2:1639638_a_at:206:587; Interrogation_Position=570; Antisense; TGGTTTTCCGGATATGGTTCCCGAG
>probe:Drosophila_2:1639638_a_at:94:245; Interrogation_Position=610; Antisense; AATTTCACCTTGACGAATCCCGTGG
>probe:Drosophila_2:1639638_a_at:725:177; Interrogation_Position=670; Antisense; AAACTTGTCTGATTTCCACGTGGGC
>probe:Drosophila_2:1639638_a_at:73:721; Interrogation_Position=683; Antisense; TTCCACGTGGGCGATCACTTAAATA

Paste this into a BLAST search page for me
GCTGTCCATTGAAACCTATACCACGGACTAAGCTGAAGATTGCGGCCAAAGAGAATATGCCCTTTCTGGCAACATGAAGCAATGGCCTATCGAAGCACCTGATTATGCCGTTTAGCATCCCGAAATTAGCATCCCGAAACAGCCATATGTGTAGTGCTACCAAATCTGGGCGATTGATTGTTCCAATCTCATCAAGTTTGGATGGCAAATTCGAGCCACCGTGGCGTGGCCCCAGGATACGTACGTGTTGTGGTTTTCCGGATATGGTTCCCGAGAATTTCACCTTGACGAATCCCGTGGAAACTTGTCTGATTTCCACGTGGGCTTCCACGTGGGCGATCACTTAAATA

Full Affymetrix probeset data:

Annotations for 1639638_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime