FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639640_at:

>probe:Drosophila_2:1639640_at:642:173; Interrogation_Position=1054; Antisense; AAAGCGTATTCTATTGGACACCACA
>probe:Drosophila_2:1639640_at:575:299; Interrogation_Position=560; Antisense; CGCGCTTCATCGTCTACAATTTGGA
>probe:Drosophila_2:1639640_at:287:5; Interrogation_Position=631; Antisense; ATTGTCTTCGATCTGGCCGAGTTCA
>probe:Drosophila_2:1639640_at:380:473; Interrogation_Position=651; Antisense; GTTCAGCACCAGCTGCATGGACTAT
>probe:Drosophila_2:1639640_at:129:111; Interrogation_Position=686; Antisense; AGAATCTCATCTGGCTGCTGGGCAA
>probe:Drosophila_2:1639640_at:181:621; Interrogation_Position=701; Antisense; TGCTGGGCAAGCACTTTCCGGAGCG
>probe:Drosophila_2:1639640_at:122:595; Interrogation_Position=728; Antisense; TGGGCGTCTGTCTGATCATCAACTC
>probe:Drosophila_2:1639640_at:577:577; Interrogation_Position=776; Antisense; GGCCGGCCATACGTGTACTGTTGGA
>probe:Drosophila_2:1639640_at:337:71; Interrogation_Position=839; Antisense; AGGCGGAGCTGTGCCAGTACCTCAT
>probe:Drosophila_2:1639640_at:337:401; Interrogation_Position=868; Antisense; GACATCCTGCCAACGGACATGTAAG
>probe:Drosophila_2:1639640_at:402:401; Interrogation_Position=883; Antisense; GACATGTAAGGCTTCCGCCACGAAA
>probe:Drosophila_2:1639640_at:302:165; Interrogation_Position=905; Antisense; AAATCAGCATCCGACGAGGCTTCTG
>probe:Drosophila_2:1639640_at:379:439; Interrogation_Position=920; Antisense; GAGGCTTCTGCTAGGCGTAGACATA
>probe:Drosophila_2:1639640_at:458:69; Interrogation_Position=985; Antisense; AGGCTTCTGAGAGCTTTTATCCAGT

Paste this into a BLAST search page for me
AAAGCGTATTCTATTGGACACCACACGCGCTTCATCGTCTACAATTTGGAATTGTCTTCGATCTGGCCGAGTTCAGTTCAGCACCAGCTGCATGGACTATAGAATCTCATCTGGCTGCTGGGCAATGCTGGGCAAGCACTTTCCGGAGCGTGGGCGTCTGTCTGATCATCAACTCGGCCGGCCATACGTGTACTGTTGGAAGGCGGAGCTGTGCCAGTACCTCATGACATCCTGCCAACGGACATGTAAGGACATGTAAGGCTTCCGCCACGAAAAAATCAGCATCCGACGAGGCTTCTGGAGGCTTCTGCTAGGCGTAGACATAAGGCTTCTGAGAGCTTTTATCCAGT

Full Affymetrix probeset data:

Annotations for 1639640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720