FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639641_at:

>probe:Drosophila_2:1639641_at:407:107; Interrogation_Position=1008; Antisense; AGAAAGCCAATCAGCAGTGCCTGCT
>probe:Drosophila_2:1639641_at:491:505; Interrogation_Position=1024; Antisense; GTGCCTGCTATGGAACCGATGCCAA
>probe:Drosophila_2:1639641_at:686:143; Interrogation_Position=1093; Antisense; ACTCCTGCTCTGATACCTTCAAGGG
>probe:Drosophila_2:1639641_at:310:633; Interrogation_Position=1131; Antisense; TCCGAGCCGGAGACTCAGTTGATTC
>probe:Drosophila_2:1639641_at:328:95; Interrogation_Position=1147; Antisense; AGTTGATTCGCGATATCCTGCTCAG
>probe:Drosophila_2:1639641_at:528:131; Interrogation_Position=1176; Antisense; ACCGGACGTGGCAAGTTCTACCTGA
>probe:Drosophila_2:1639641_at:45:67; Interrogation_Position=1213; Antisense; ATGGCAACTACCTGCTGTATCCTTG
>probe:Drosophila_2:1639641_at:74:449; Interrogation_Position=1302; Antisense; GATGCCATCAAGAGTGCGACCGGAA
>probe:Drosophila_2:1639641_at:707:135; Interrogation_Position=1326; Antisense; ACGAAGTATACCGTGGGCAGTTCCA
>probe:Drosophila_2:1639641_at:444:347; Interrogation_Position=1378; Antisense; GCAGTGACGACTATGCCTTCGGAGT
>probe:Drosophila_2:1639641_at:603:189; Interrogation_Position=1407; Antisense; AACTTCCCGGTGTCGATTACCATGG
>probe:Drosophila_2:1639641_at:644:461; Interrogation_Position=1421; Antisense; GATTACCATGGAACTGCCGGCCGGC
>probe:Drosophila_2:1639641_at:134:97; Interrogation_Position=1474; Antisense; AGATCGAGGGCTTCGTTTCCGAGAC
>probe:Drosophila_2:1639641_at:191:315; Interrogation_Position=1515; Antisense; GCCATGGCCCAGAAGGTTGCCGATA

Paste this into a BLAST search page for me
AGAAAGCCAATCAGCAGTGCCTGCTGTGCCTGCTATGGAACCGATGCCAAACTCCTGCTCTGATACCTTCAAGGGTCCGAGCCGGAGACTCAGTTGATTCAGTTGATTCGCGATATCCTGCTCAGACCGGACGTGGCAAGTTCTACCTGAATGGCAACTACCTGCTGTATCCTTGGATGCCATCAAGAGTGCGACCGGAAACGAAGTATACCGTGGGCAGTTCCAGCAGTGACGACTATGCCTTCGGAGTAACTTCCCGGTGTCGATTACCATGGGATTACCATGGAACTGCCGGCCGGCAGATCGAGGGCTTCGTTTCCGAGACGCCATGGCCCAGAAGGTTGCCGATA

Full Affymetrix probeset data:

Annotations for 1639641_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720