FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639643_at:

>probe:Drosophila_2:1639643_at:660:113; Interrogation_Position=446; Antisense; AGCAGCTGGCTGGTAAAACGATTCA
>probe:Drosophila_2:1639643_at:404:713; Interrogation_Position=467; Antisense; TTCAGTGGCGAACTGCGACCAGGAT
>probe:Drosophila_2:1639643_at:674:465; Interrogation_Position=489; Antisense; GATTGTATCGCATCCGGACTTCAAC
>probe:Drosophila_2:1639643_at:533:673; Interrogation_Position=536; Antisense; TAGCCCTGATCGTACTGGAAACTTC
>probe:Drosophila_2:1639643_at:101:83; Interrogation_Position=609; Antisense; AGTGTCTTTCGATCGGGAACGCTGC
>probe:Drosophila_2:1639643_at:536:547; Interrogation_Position=650; Antisense; GGAGGCCGGATTTCCTTGCCAAGAA
>probe:Drosophila_2:1639643_at:518:387; Interrogation_Position=693; Antisense; GAAAATCGATCTGCCCATCGTGAGC
>probe:Drosophila_2:1639643_at:484:419; Interrogation_Position=714; Antisense; GAGCAGGTCCGATTGCGAATCCCTA
>probe:Drosophila_2:1639643_at:486:407; Interrogation_Position=747; Antisense; GACGGCGTTTGTCCAGAGCTTCCAG
>probe:Drosophila_2:1639643_at:567:585; Interrogation_Position=773; Antisense; TGGACCCCACCATATTGTGTGCTGG
>probe:Drosophila_2:1639643_at:264:645; Interrogation_Position=875; Antisense; TCTACGAGCTCGTCGGGATTGTGAA
>probe:Drosophila_2:1639643_at:295:613; Interrogation_Position=896; Antisense; TGAACAGCGGCTTTTCTTGCGGACT
>probe:Drosophila_2:1639643_at:1:371; Interrogation_Position=924; Antisense; GAATGTGCCTGCCTTATACACGAAC
>probe:Drosophila_2:1639643_at:559:189; Interrogation_Position=946; Antisense; AACATCTCGCACATGAGGCCTTGGA

Paste this into a BLAST search page for me
AGCAGCTGGCTGGTAAAACGATTCATTCAGTGGCGAACTGCGACCAGGATGATTGTATCGCATCCGGACTTCAACTAGCCCTGATCGTACTGGAAACTTCAGTGTCTTTCGATCGGGAACGCTGCGGAGGCCGGATTTCCTTGCCAAGAAGAAAATCGATCTGCCCATCGTGAGCGAGCAGGTCCGATTGCGAATCCCTAGACGGCGTTTGTCCAGAGCTTCCAGTGGACCCCACCATATTGTGTGCTGGTCTACGAGCTCGTCGGGATTGTGAATGAACAGCGGCTTTTCTTGCGGACTGAATGTGCCTGCCTTATACACGAACAACATCTCGCACATGAGGCCTTGGA

Full Affymetrix probeset data:

Annotations for 1639643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720