Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639644_at:

>probe:Drosophila_2:1639644_at:691:135; Interrogation_Position=2585; Antisense; ACGATAAGGAACGTGCCCTGCGTGC
>probe:Drosophila_2:1639644_at:233:639; Interrogation_Position=2617; Antisense; TCGGTCACTGTTGTGGAGCGCGCCA
>probe:Drosophila_2:1639644_at:18:213; Interrogation_Position=2641; Antisense; AAGACTCTGTGCGAAGCCAATCCCA
>probe:Drosophila_2:1639644_at:165:233; Interrogation_Position=2665; Antisense; AATGCCACCGTGCTGGTCGAGCAGT
>probe:Drosophila_2:1639644_at:523:501; Interrogation_Position=2680; Antisense; GTCGAGCAGTTGGAAGCCTTTAACA
>probe:Drosophila_2:1639644_at:533:227; Interrogation_Position=2710; Antisense; AAGGCGCTGGATGCCGCACTGAAGC
>probe:Drosophila_2:1639644_at:193:143; Interrogation_Position=2727; Antisense; ACTGAAGCAAGTGCGCAGCCAGCTG
>probe:Drosophila_2:1639644_at:559:625; Interrogation_Position=2760; Antisense; TGCCGCCATGTTTCTGTCAGTGGAT
>probe:Drosophila_2:1639644_at:323:447; Interrogation_Position=2782; Antisense; GATGCGGACTCCAAGAAGATCTTCT
>probe:Drosophila_2:1639644_at:427:211; Interrogation_Position=2794; Antisense; AAGAAGATCTTCTGTCTCAGCTCGG
>probe:Drosophila_2:1639644_at:534:279; Interrogation_Position=2814; Antisense; CTCGGTGCCGAAAAGTGCCGTGGAA
>probe:Drosophila_2:1639644_at:470:59; Interrogation_Position=2870; Antisense; ATGTTTCCGCCACGCTGGGAGGCAA
>probe:Drosophila_2:1639644_at:228:249; Interrogation_Position=2963; Antisense; AATTGGCCAGCAAATTCGCTCAGTC
>probe:Drosophila_2:1639644_at:44:121; Interrogation_Position=3019; Antisense; AGCGGCAAGACCTTCAATTACTCAC

Paste this into a BLAST search page for me
ACGATAAGGAACGTGCCCTGCGTGCTCGGTCACTGTTGTGGAGCGCGCCAAAGACTCTGTGCGAAGCCAATCCCAAATGCCACCGTGCTGGTCGAGCAGTGTCGAGCAGTTGGAAGCCTTTAACAAAGGCGCTGGATGCCGCACTGAAGCACTGAAGCAAGTGCGCAGCCAGCTGTGCCGCCATGTTTCTGTCAGTGGATGATGCGGACTCCAAGAAGATCTTCTAAGAAGATCTTCTGTCTCAGCTCGGCTCGGTGCCGAAAAGTGCCGTGGAAATGTTTCCGCCACGCTGGGAGGCAAAATTGGCCAGCAAATTCGCTCAGTCAGCGGCAAGACCTTCAATTACTCAC

Full Affymetrix probeset data:

Annotations for 1639644_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime