FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639645_at:

>probe:Drosophila_2:1639645_at:463:375; Interrogation_Position=140; Antisense; GAAGAAGTACCGAGCGCTGTGCACC
>probe:Drosophila_2:1639645_at:644:509; Interrogation_Position=158; Antisense; GTGCACCCACTGTCGGAAATGCCAA
>probe:Drosophila_2:1639645_at:185:373; Interrogation_Position=218; Antisense; GAAGTCATGTCTCAAGTTCCGGGAG
>probe:Drosophila_2:1639645_at:41:469; Interrogation_Position=233; Antisense; GTTCCGGGAGGATCTAACCGCTGAA
>probe:Drosophila_2:1639645_at:388:337; Interrogation_Position=313; Antisense; GCTCCACAATTGACTTCACTTCGAA
>probe:Drosophila_2:1639645_at:38:13; Interrogation_Position=339; Antisense; ATTCTACTGGACAAACTGATCGACG
>probe:Drosophila_2:1639645_at:443:509; Interrogation_Position=376; Antisense; GTGCACGCAATCAGGAATCCAACTT
>probe:Drosophila_2:1639645_at:227:513; Interrogation_Position=402; Antisense; GTGAGCTACTTGACCGATCTGGATC
>probe:Drosophila_2:1639645_at:44:35; Interrogation_Position=424; Antisense; ATCAACTGGTGATCCCGTCATCCGA
>probe:Drosophila_2:1639645_at:727:43; Interrogation_Position=443; Antisense; ATCCGACGCCAATCGACTGCAGAAG
>probe:Drosophila_2:1639645_at:636:283; Interrogation_Position=495; Antisense; CTGGTGGTCAAATCCGAGTACTTTA
>probe:Drosophila_2:1639645_at:134:261; Interrogation_Position=551; Antisense; CACCGTCACCTTGTTGGAGGCGAAA
>probe:Drosophila_2:1639645_at:521:425; Interrogation_Position=588; Antisense; GAGATCGCCAAACTGCGTGCTGAAT
>probe:Drosophila_2:1639645_at:638:333; Interrogation_Position=606; Antisense; GCTGAATGCGAGTAGCCTAAGCTTT

Paste this into a BLAST search page for me
GAAGAAGTACCGAGCGCTGTGCACCGTGCACCCACTGTCGGAAATGCCAAGAAGTCATGTCTCAAGTTCCGGGAGGTTCCGGGAGGATCTAACCGCTGAAGCTCCACAATTGACTTCACTTCGAAATTCTACTGGACAAACTGATCGACGGTGCACGCAATCAGGAATCCAACTTGTGAGCTACTTGACCGATCTGGATCATCAACTGGTGATCCCGTCATCCGAATCCGACGCCAATCGACTGCAGAAGCTGGTGGTCAAATCCGAGTACTTTACACCGTCACCTTGTTGGAGGCGAAAGAGATCGCCAAACTGCGTGCTGAATGCTGAATGCGAGTAGCCTAAGCTTT

Full Affymetrix probeset data:

Annotations for 1639645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720