FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639646_at:

>probe:Drosophila_2:1639646_at:396:619; Interrogation_Position=145; Antisense; TGCATCCCGCTTCTATGCGAAGAAC
>probe:Drosophila_2:1639646_at:498:375; Interrogation_Position=163; Antisense; GAAGAACCAAGGAGCAGCCAGCCAA
>probe:Drosophila_2:1639646_at:344:401; Interrogation_Position=200; Antisense; GACATGGTCAGCGATGAGCCCATCA
>probe:Drosophila_2:1639646_at:469:271; Interrogation_Position=220; Antisense; CATCAAGTTTTTCGGCAGCCAGGCG
>probe:Drosophila_2:1639646_at:487:519; Interrogation_Position=276; Antisense; GTGGCAGCGACGAGACCCTTTGGTA
>probe:Drosophila_2:1639646_at:421:103; Interrogation_Position=366; Antisense; AGAGCGACATCGATCTCCGGTTGGA
>probe:Drosophila_2:1639646_at:260:599; Interrogation_Position=399; Antisense; TGTACGAGCATGTCAGTGGTCTGGA
>probe:Drosophila_2:1639646_at:57:77; Interrogation_Position=423; Antisense; AGGAGGTGCAGCTGACTGTCAACTA
>probe:Drosophila_2:1639646_at:653:159; Interrogation_Position=456; Antisense; ACAAGGAACACGGACTGGACACCAA
>probe:Drosophila_2:1639646_at:436:451; Interrogation_Position=515; Antisense; GATCTGGGCCAGTTGGATGCCAAGT
>probe:Drosophila_2:1639646_at:717:637; Interrogation_Position=539; Antisense; TTGGCCGCCCAGTAGTCGTAGGGTT
>probe:Drosophila_2:1639646_at:208:373; Interrogation_Position=618; Antisense; GAAGATGTATGTTTCTACCAGGGTA
>probe:Drosophila_2:1639646_at:77:387; Interrogation_Position=73; Antisense; GAAAATGCTGCGTTTGCTTACAAAA
>probe:Drosophila_2:1639646_at:135:181; Interrogation_Position=96; Antisense; AAACAAGGGTGCTGCGCCAACTGAT

Paste this into a BLAST search page for me
TGCATCCCGCTTCTATGCGAAGAACGAAGAACCAAGGAGCAGCCAGCCAAGACATGGTCAGCGATGAGCCCATCACATCAAGTTTTTCGGCAGCCAGGCGGTGGCAGCGACGAGACCCTTTGGTAAGAGCGACATCGATCTCCGGTTGGATGTACGAGCATGTCAGTGGTCTGGAAGGAGGTGCAGCTGACTGTCAACTAACAAGGAACACGGACTGGACACCAAGATCTGGGCCAGTTGGATGCCAAGTTTGGCCGCCCAGTAGTCGTAGGGTTGAAGATGTATGTTTCTACCAGGGTAGAAAATGCTGCGTTTGCTTACAAAAAAACAAGGGTGCTGCGCCAACTGAT

Full Affymetrix probeset data:

Annotations for 1639646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720