FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639647_at:

>probe:Drosophila_2:1639647_at:311:83; Interrogation_Position=1001; Antisense; AGTGGCCGGCGGATAGCCTCAACTA
>probe:Drosophila_2:1639647_at:168:675; Interrogation_Position=1014; Antisense; TAGCCTCAACTACGAGCGGGCATAC
>probe:Drosophila_2:1639647_at:490:121; Interrogation_Position=1028; Antisense; AGCGGGCATACAACCTGTTCCTGGA
>probe:Drosophila_2:1639647_at:684:641; Interrogation_Position=1083; Antisense; TCTGAGCTTCACCTATCTTTTTATC
>probe:Drosophila_2:1639647_at:171:355; Interrogation_Position=1112; Antisense; GCACCCTGTACGTGAGCATGCGCAA
>probe:Drosophila_2:1639647_at:639:323; Interrogation_Position=1131; Antisense; GCGCAACGAGCGAGCCATGAACTTT
>probe:Drosophila_2:1639647_at:673:187; Interrogation_Position=1252; Antisense; AACACGATGACCATGCTCCTTGGGC
>probe:Drosophila_2:1639647_at:173:487; Interrogation_Position=1284; Antisense; GTACGAGTACGTGGGCTATACCTCC
>probe:Drosophila_2:1639647_at:594:321; Interrogation_Position=1391; Antisense; GCGCCTTCGTGGACACCTTTAAGGG
>probe:Drosophila_2:1639647_at:308:583; Interrogation_Position=1456; Antisense; TGGCGGCGACGCTCCAAGAACGAGA
>probe:Drosophila_2:1639647_at:446:691; Interrogation_Position=1487; Antisense; TTTCGGTGGCCGGTAACTCCATTGC
>probe:Drosophila_2:1639647_at:318:7; Interrogation_Position=1507; Antisense; ATTGCGCTGGCCAACTCGGTCATGT
>probe:Drosophila_2:1639647_at:509:157; Interrogation_Position=1538; Antisense; ACACGATCCTCGAGAGTCCGCGACT
>probe:Drosophila_2:1639647_at:284:75; Interrogation_Position=978; Antisense; AGGACTTCGCAAGTGCCGCGAGCAG

Paste this into a BLAST search page for me
AGTGGCCGGCGGATAGCCTCAACTATAGCCTCAACTACGAGCGGGCATACAGCGGGCATACAACCTGTTCCTGGATCTGAGCTTCACCTATCTTTTTATCGCACCCTGTACGTGAGCATGCGCAAGCGCAACGAGCGAGCCATGAACTTTAACACGATGACCATGCTCCTTGGGCGTACGAGTACGTGGGCTATACCTCCGCGCCTTCGTGGACACCTTTAAGGGTGGCGGCGACGCTCCAAGAACGAGATTTCGGTGGCCGGTAACTCCATTGCATTGCGCTGGCCAACTCGGTCATGTACACGATCCTCGAGAGTCCGCGACTAGGACTTCGCAAGTGCCGCGAGCAG

Full Affymetrix probeset data:

Annotations for 1639647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720