FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639648_at:

>probe:Drosophila_2:1639648_at:566:87; Interrogation_Position=1042; Antisense; AGTCGCGCCCCATTTGGATGACAGA
>probe:Drosophila_2:1639648_at:641:31; Interrogation_Position=1077; Antisense; ATAACCGACACGGATGCTGCCGATG
>probe:Drosophila_2:1639648_at:74:51; Interrogation_Position=1230; Antisense; ATGCGAGTGGGCTCATCGAACGCCA
>probe:Drosophila_2:1639648_at:553:193; Interrogation_Position=1254; Antisense; AACTCTAGCGATTCCAGCGACGACG
>probe:Drosophila_2:1639648_at:451:251; Interrogation_Position=1298; Antisense; CAAGATTCCTGATGTCGACTTCGAC
>probe:Drosophila_2:1639648_at:146:23; Interrogation_Position=1327; Antisense; ATATCAACTCAGATTCCGCGGAGGA
>probe:Drosophila_2:1639648_at:477:597; Interrogation_Position=1370; Antisense; TGTGCTAGTGGCTGGACGACCGCAT
>probe:Drosophila_2:1639648_at:312:413; Interrogation_Position=1401; Antisense; GACCAACTGGACGACAACCTGATAG
>probe:Drosophila_2:1639648_at:430:605; Interrogation_Position=1420; Antisense; TGATAGCCCAGATGACGCCGCAGGA
>probe:Drosophila_2:1639648_at:669:665; Interrogation_Position=1455; Antisense; TACATACACGTATACCAGCAGCACT
>probe:Drosophila_2:1639648_at:549:433; Interrogation_Position=1498; Antisense; GAGGGCGTCTGCAATTAGCCACGAT
>probe:Drosophila_2:1639648_at:584:257; Interrogation_Position=1517; Antisense; CACGATTTCTACGTTTTCCACGAGT
>probe:Drosophila_2:1639648_at:656:429; Interrogation_Position=1538; Antisense; GAGTTTCCCATCTCACGCATAGAGT
>probe:Drosophila_2:1639648_at:505:215; Interrogation_Position=1574; Antisense; AAGTTACCCACTAGTTCGAGCGAAT

Paste this into a BLAST search page for me
AGTCGCGCCCCATTTGGATGACAGAATAACCGACACGGATGCTGCCGATGATGCGAGTGGGCTCATCGAACGCCAAACTCTAGCGATTCCAGCGACGACGCAAGATTCCTGATGTCGACTTCGACATATCAACTCAGATTCCGCGGAGGATGTGCTAGTGGCTGGACGACCGCATGACCAACTGGACGACAACCTGATAGTGATAGCCCAGATGACGCCGCAGGATACATACACGTATACCAGCAGCACTGAGGGCGTCTGCAATTAGCCACGATCACGATTTCTACGTTTTCCACGAGTGAGTTTCCCATCTCACGCATAGAGTAAGTTACCCACTAGTTCGAGCGAAT

Full Affymetrix probeset data:

Annotations for 1639648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720