FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639653_at:

>probe:Drosophila_2:1639653_at:595:397; Interrogation_Position=1029; Antisense; GACAAGATCTGGCTGATGTCCATCT
>probe:Drosophila_2:1639653_at:222:35; Interrogation_Position=1050; Antisense; ATCTTCCAGTTCGTCAACGTGGTAT
>probe:Drosophila_2:1639653_at:463:195; Interrogation_Position=1065; Antisense; AACGTGGTATACTTCCTCACCGAGG
>probe:Drosophila_2:1639653_at:243:433; Interrogation_Position=1086; Antisense; GAGGTTATCTGGTGGTACACGCCTA
>probe:Drosophila_2:1639653_at:298:537; Interrogation_Position=1099; Antisense; GGTACACGCCTAGCATCTGGATCGT
>probe:Drosophila_2:1639653_at:152:511; Interrogation_Position=1170; Antisense; GTGAACACCTTCTATCGGATGTCCA
>probe:Drosophila_2:1639653_at:423:503; Interrogation_Position=1190; Antisense; GTCCAAGGAGATTTCGCCGGAGCGC
>probe:Drosophila_2:1639653_at:593:579; Interrogation_Position=1228; Antisense; TGGCCATGGTGGTACAGTCGGACTC
>probe:Drosophila_2:1639653_at:655:87; Interrogation_Position=1243; Antisense; AGTCGGACTCCTATGGCATTGCTCT
>probe:Drosophila_2:1639653_at:490:123; Interrogation_Position=1329; Antisense; AGCCTTGTTTGGTGATACGGATCGA
>probe:Drosophila_2:1639653_at:28:51; Interrogation_Position=1376; Antisense; ATGCCTTTACTGTGTGCGTGTTTAG
>probe:Drosophila_2:1639653_at:282:599; Interrogation_Position=1416; Antisense; TGTCTGTGCATGTCCCTATAGTATT
>probe:Drosophila_2:1639653_at:408:143; Interrogation_Position=1445; Antisense; ACTGGATCACTGGACATCCGGTAAC
>probe:Drosophila_2:1639653_at:284:97; Interrogation_Position=982; Antisense; AGATCGGAGTCTTTATCTCGCGCTC

Paste this into a BLAST search page for me
GACAAGATCTGGCTGATGTCCATCTATCTTCCAGTTCGTCAACGTGGTATAACGTGGTATACTTCCTCACCGAGGGAGGTTATCTGGTGGTACACGCCTAGGTACACGCCTAGCATCTGGATCGTGTGAACACCTTCTATCGGATGTCCAGTCCAAGGAGATTTCGCCGGAGCGCTGGCCATGGTGGTACAGTCGGACTCAGTCGGACTCCTATGGCATTGCTCTAGCCTTGTTTGGTGATACGGATCGAATGCCTTTACTGTGTGCGTGTTTAGTGTCTGTGCATGTCCCTATAGTATTACTGGATCACTGGACATCCGGTAACAGATCGGAGTCTTTATCTCGCGCTC

Full Affymetrix probeset data:

Annotations for 1639653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720