Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639654_at:

>probe:Drosophila_2:1639654_at:271:101; Interrogation_Position=285; Antisense; AGAGTGTTCAATTCTCGGTGGCCGA
>probe:Drosophila_2:1639654_at:641:171; Interrogation_Position=316; Antisense; AAAGAAATTCCAGCAGGCACCCACT
>probe:Drosophila_2:1639654_at:428:147; Interrogation_Position=338; Antisense; ACTATTGTGGTCAATTCGGCTGGAA
>probe:Drosophila_2:1639654_at:600:133; Interrogation_Position=365; Antisense; ACCCGAGATGGTTATCTGCTCAAGA
>probe:Drosophila_2:1639654_at:574:623; Interrogation_Position=390; Antisense; TGCCCGAACGGGACTACGATGACGT
>probe:Drosophila_2:1639654_at:360:371; Interrogation_Position=430; Antisense; GAAGGGCACCTTTCTGGTTACCCAG
>probe:Drosophila_2:1639654_at:309:177; Interrogation_Position=490; Antisense; AAACGGCACCATTGTGAACCTCTCA
>probe:Drosophila_2:1639654_at:198:381; Interrogation_Position=505; Antisense; GAACCTCTCAAGCATCGTGGCCAAG
>probe:Drosophila_2:1639654_at:8:215; Interrogation_Position=527; Antisense; AAGATGAACAACGTGGGCCAGGCCA
>probe:Drosophila_2:1639654_at:351:481; Interrogation_Position=616; Antisense; GTTTGGCATCCGTGTGAACTGCATC
>probe:Drosophila_2:1639654_at:692:71; Interrogation_Position=646; Antisense; AGGCTACATAGACACGCCCATGGTA
>probe:Drosophila_2:1639654_at:92:291; Interrogation_Position=672; Antisense; CGGTTGTGCCCGATTCTGTAAAGCA
>probe:Drosophila_2:1639654_at:508:75; Interrogation_Position=696; Antisense; AGGAGGTGGTACAACGATGCCCCTT
>probe:Drosophila_2:1639654_at:597:97; Interrogation_Position=744; Antisense; AGATCGCCGAGGTCATTGCCTTTTT

Paste this into a BLAST search page for me
AGAGTGTTCAATTCTCGGTGGCCGAAAAGAAATTCCAGCAGGCACCCACTACTATTGTGGTCAATTCGGCTGGAAACCCGAGATGGTTATCTGCTCAAGATGCCCGAACGGGACTACGATGACGTGAAGGGCACCTTTCTGGTTACCCAGAAACGGCACCATTGTGAACCTCTCAGAACCTCTCAAGCATCGTGGCCAAGAAGATGAACAACGTGGGCCAGGCCAGTTTGGCATCCGTGTGAACTGCATCAGGCTACATAGACACGCCCATGGTACGGTTGTGCCCGATTCTGTAAAGCAAGGAGGTGGTACAACGATGCCCCTTAGATCGCCGAGGTCATTGCCTTTTT

Full Affymetrix probeset data:

Annotations for 1639654_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime