FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639659_at:

>probe:Drosophila_2:1639659_at:40:341; Interrogation_Position=1012; Antisense; GCTACGTGGAGGAGCTTCTCATCAA
>probe:Drosophila_2:1639659_at:700:585; Interrogation_Position=1159; Antisense; TGGAGAAGTCGAACTCTGGCTGCCG
>probe:Drosophila_2:1639659_at:374:721; Interrogation_Position=1185; Antisense; TTGACTTCCTTCTGGTGACCGCGAG
>probe:Drosophila_2:1639659_at:133:129; Interrogation_Position=1224; Antisense; ACCACAAAGTTAGTCCGTGCGATTT
>probe:Drosophila_2:1639659_at:659:459; Interrogation_Position=1244; Antisense; GATTTGCAGGAGGTCCAGCATCTGA
>probe:Drosophila_2:1639659_at:549:519; Interrogation_Position=707; Antisense; GGACAAGTACTTCGGAAACTCGGCG
>probe:Drosophila_2:1639659_at:607:397; Interrogation_Position=741; Antisense; GACAAGACCTTTCGTCAGTTCAAAA
>probe:Drosophila_2:1639659_at:62:181; Interrogation_Position=769; Antisense; AAACAGCAGCCGAACCCGATCAGAT
>probe:Drosophila_2:1639659_at:657:293; Interrogation_Position=785; Antisense; CGATCAGATCGTGCGCTACAAACGT
>probe:Drosophila_2:1639659_at:172:553; Interrogation_Position=854; Antisense; GGACCAACTTAACAAGCTGCCCAAT
>probe:Drosophila_2:1639659_at:244:337; Interrogation_Position=869; Antisense; GCTGCCCAATTGCATTGCTTGCGGA
>probe:Drosophila_2:1639659_at:283:101; Interrogation_Position=896; Antisense; AGAGCGTCAGTTCGAATTTCAGATT
>probe:Drosophila_2:1639659_at:534:363; Interrogation_Position=909; Antisense; GAATTTCAGATTATGCCGCAAGCGC
>probe:Drosophila_2:1639659_at:329:205; Interrogation_Position=928; Antisense; AAGCGCTGACTCTTCTGGAGGACGA

Paste this into a BLAST search page for me
GCTACGTGGAGGAGCTTCTCATCAATGGAGAAGTCGAACTCTGGCTGCCGTTGACTTCCTTCTGGTGACCGCGAGACCACAAAGTTAGTCCGTGCGATTTGATTTGCAGGAGGTCCAGCATCTGAGGACAAGTACTTCGGAAACTCGGCGGACAAGACCTTTCGTCAGTTCAAAAAAACAGCAGCCGAACCCGATCAGATCGATCAGATCGTGCGCTACAAACGTGGACCAACTTAACAAGCTGCCCAATGCTGCCCAATTGCATTGCTTGCGGAAGAGCGTCAGTTCGAATTTCAGATTGAATTTCAGATTATGCCGCAAGCGCAAGCGCTGACTCTTCTGGAGGACGA

Full Affymetrix probeset data:

Annotations for 1639659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720