Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639662_at:

>probe:Drosophila_2:1639662_at:634:211; Interrogation_Position=1291; Antisense; AAGACGAGGATAGCCAGTACGAGGA
>probe:Drosophila_2:1639662_at:682:293; Interrogation_Position=1310; Antisense; CGAGGATAGCCAGGACATTCACATG
>probe:Drosophila_2:1639662_at:181:75; Interrogation_Position=1321; Antisense; AGGACATTCACATGGTGCTCCAAAG
>probe:Drosophila_2:1639662_at:507:535; Interrogation_Position=1334; Antisense; GGTGCTCCAAAGAGACCACTGATAT
>probe:Drosophila_2:1639662_at:117:415; Interrogation_Position=1347; Antisense; GACCACTGATATCGTGACGTCGTCG
>probe:Drosophila_2:1639662_at:319:611; Interrogation_Position=1361; Antisense; TGACGTCGTCGGTTTTTAATTCCTG
>probe:Drosophila_2:1639662_at:162:539; Interrogation_Position=1371; Antisense; GGTTTTTAATTCCTGGCCAAGCTCA
>probe:Drosophila_2:1639662_at:68:581; Interrogation_Position=1385; Antisense; GGCCAAGCTCATTGTCAACTCAAAA
>probe:Drosophila_2:1639662_at:305:171; Interrogation_Position=1416; Antisense; AAAGAACTAGTCAAAGCACACGGTA
>probe:Drosophila_2:1639662_at:185:209; Interrogation_Position=1429; Antisense; AAGCACACGGTAGCCTCGAAGGAGT
>probe:Drosophila_2:1639662_at:391:369; Interrogation_Position=1468; Antisense; GAAGGCTGCCTGCTTTTCAAAATTA
>probe:Drosophila_2:1639662_at:125:129; Interrogation_Position=1512; Antisense; ACCAAATTCACATTTTCTCCACTGC
>probe:Drosophila_2:1639662_at:440:713; Interrogation_Position=1526; Antisense; TTCTCCACTGCTTTTGTATTTCATG
>probe:Drosophila_2:1639662_at:570:283; Interrogation_Position=1533; Antisense; CTGCTTTTGTATTTCATGGTTTGGA

Paste this into a BLAST search page for me
AAGACGAGGATAGCCAGTACGAGGACGAGGATAGCCAGGACATTCACATGAGGACATTCACATGGTGCTCCAAAGGGTGCTCCAAAGAGACCACTGATATGACCACTGATATCGTGACGTCGTCGTGACGTCGTCGGTTTTTAATTCCTGGGTTTTTAATTCCTGGCCAAGCTCAGGCCAAGCTCATTGTCAACTCAAAAAAAGAACTAGTCAAAGCACACGGTAAAGCACACGGTAGCCTCGAAGGAGTGAAGGCTGCCTGCTTTTCAAAATTAACCAAATTCACATTTTCTCCACTGCTTCTCCACTGCTTTTGTATTTCATGCTGCTTTTGTATTTCATGGTTTGGA

Full Affymetrix probeset data:

Annotations for 1639662_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime