FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639663_at:

>probe:Drosophila_2:1639663_at:388:321; Interrogation_Position=1250; Antisense; GCGCCCAGTAGTAGTGTTAGTGCCA
>probe:Drosophila_2:1639663_at:521:667; Interrogation_Position=1289; Antisense; TACTTGAGTCAACGGCATGGGCACA
>probe:Drosophila_2:1639663_at:664:719; Interrogation_Position=1356; Antisense; TTCCTCTGCGTTTGGAAGCCAACAA
>probe:Drosophila_2:1639663_at:546:449; Interrogation_Position=1436; Antisense; GATCCGGATGCCATGTTTCTGATGA
>probe:Drosophila_2:1639663_at:106:603; Interrogation_Position=1449; Antisense; TGTTTCTGATGAGCCTGCTGCCCGA
>probe:Drosophila_2:1639663_at:146:283; Interrogation_Position=1466; Antisense; CTGCCCGACATCCAAAAGCTGAACG
>probe:Drosophila_2:1639663_at:255:613; Interrogation_Position=1485; Antisense; TGAACGGCCGTGATCGCGGCAAGAT
>probe:Drosophila_2:1639663_at:688:213; Interrogation_Position=1511; Antisense; AAGATAGCCTTCCAGAACATCCTGC
>probe:Drosophila_2:1639663_at:260:555; Interrogation_Position=1537; Antisense; GGACTACCTGTATCCGGATTAGCGT
>probe:Drosophila_2:1639663_at:49:15; Interrogation_Position=1554; Antisense; ATTAGCGTTGATCTCTGTGTATACC
>probe:Drosophila_2:1639663_at:440:593; Interrogation_Position=1569; Antisense; TGTGTATACCTTCCGCTTAACGCAA
>probe:Drosophila_2:1639663_at:44:381; Interrogation_Position=1597; Antisense; GAACCCAGTTCCAGTATCGATTTTG
>probe:Drosophila_2:1639663_at:72:691; Interrogation_Position=1627; Antisense; TATTCTCTTTTGTATTTTCGTTGGA
>probe:Drosophila_2:1639663_at:54:367; Interrogation_Position=1662; Antisense; GAATCCTTTAAGCTTCGCTGTGCAA

Paste this into a BLAST search page for me
GCGCCCAGTAGTAGTGTTAGTGCCATACTTGAGTCAACGGCATGGGCACATTCCTCTGCGTTTGGAAGCCAACAAGATCCGGATGCCATGTTTCTGATGATGTTTCTGATGAGCCTGCTGCCCGACTGCCCGACATCCAAAAGCTGAACGTGAACGGCCGTGATCGCGGCAAGATAAGATAGCCTTCCAGAACATCCTGCGGACTACCTGTATCCGGATTAGCGTATTAGCGTTGATCTCTGTGTATACCTGTGTATACCTTCCGCTTAACGCAAGAACCCAGTTCCAGTATCGATTTTGTATTCTCTTTTGTATTTTCGTTGGAGAATCCTTTAAGCTTCGCTGTGCAA

Full Affymetrix probeset data:

Annotations for 1639663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720