FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639665_at:

>probe:Drosophila_2:1639665_at:650:547; Interrogation_Position=1819; Antisense; GGATGGTTTCATGACCCAGTGCATT
>probe:Drosophila_2:1639665_at:181:85; Interrogation_Position=1836; Antisense; AGTGCATTCATGGTAATCGCGATCA
>probe:Drosophila_2:1639665_at:437:589; Interrogation_Position=1863; Antisense; TGGATCGTGAGCAGGCTATTGCCGA
>probe:Drosophila_2:1639665_at:168:303; Interrogation_Position=1884; Antisense; CCGATATTAAGTCCGGCGTCGTGCG
>probe:Drosophila_2:1639665_at:80:637; Interrogation_Position=1902; Antisense; TCGTGCGCATTCTGGTTGCTACCGA
>probe:Drosophila_2:1639665_at:664:63; Interrogation_Position=1926; Antisense; ATGTGGCATCACGTGGCCTGGACAT
>probe:Drosophila_2:1639665_at:571:681; Interrogation_Position=1976; Antisense; TATGATTTTCCGCACAACATCGAGG
>probe:Drosophila_2:1639665_at:694:269; Interrogation_Position=1993; Antisense; CATCGAGGAGTATGTGCACCGTGTT
>probe:Drosophila_2:1639665_at:7:623; Interrogation_Position=2032; Antisense; TGCTGGCCGACAGGGCACATCAATA
>probe:Drosophila_2:1639665_at:71:239; Interrogation_Position=2053; Antisense; AATAAGCTTTTTTACGCGCGAGGAT
>probe:Drosophila_2:1639665_at:109:195; Interrogation_Position=2139; Antisense; AACTGCACAACATGGCTAGACGCTT
>probe:Drosophila_2:1639665_at:149:575; Interrogation_Position=2243; Antisense; GGCGGACGCCGAAATTTCGATCAAT
>probe:Drosophila_2:1639665_at:261:121; Interrogation_Position=2312; Antisense; AGCGCATTGAAGTGCCTTGCCAAAA
>probe:Drosophila_2:1639665_at:422:453; Interrogation_Position=2371; Antisense; GATCATAACCCAAAACATGCCGTGT

Paste this into a BLAST search page for me
GGATGGTTTCATGACCCAGTGCATTAGTGCATTCATGGTAATCGCGATCATGGATCGTGAGCAGGCTATTGCCGACCGATATTAAGTCCGGCGTCGTGCGTCGTGCGCATTCTGGTTGCTACCGAATGTGGCATCACGTGGCCTGGACATTATGATTTTCCGCACAACATCGAGGCATCGAGGAGTATGTGCACCGTGTTTGCTGGCCGACAGGGCACATCAATAAATAAGCTTTTTTACGCGCGAGGATAACTGCACAACATGGCTAGACGCTTGGCGGACGCCGAAATTTCGATCAATAGCGCATTGAAGTGCCTTGCCAAAAGATCATAACCCAAAACATGCCGTGT

Full Affymetrix probeset data:

Annotations for 1639665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720