FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639666_at:

>probe:Drosophila_2:1639666_at:629:589; Interrogation_Position=2277; Antisense; TGGTATGTTCCAAACCAAGGCGAAC
>probe:Drosophila_2:1639666_at:485:395; Interrogation_Position=2320; Antisense; GAAATCGTGGTCAATGCGGAAAGCA
>probe:Drosophila_2:1639666_at:287:351; Interrogation_Position=2350; Antisense; GCAGAGGCTATACCCACAGATTACT
>probe:Drosophila_2:1639666_at:602:441; Interrogation_Position=2368; Antisense; GATTACTCCACATTTAAGAACCGGG
>probe:Drosophila_2:1639666_at:596:379; Interrogation_Position=2385; Antisense; GAACCGGGTTTTGCTACTGCGAACG
>probe:Drosophila_2:1639666_at:533:135; Interrogation_Position=2415; Antisense; ACGAAGTATCAGTTTTGCGAAAAGC
>probe:Drosophila_2:1639666_at:704:403; Interrogation_Position=2500; Antisense; GACTCCACGCATCTGGAGAAGGCTT
>probe:Drosophila_2:1639666_at:88:423; Interrogation_Position=2515; Antisense; GAGAAGGCTTGCTACTGGCTGCTAA
>probe:Drosophila_2:1639666_at:670:339; Interrogation_Position=2525; Antisense; GCTACTGGCTGCTAATAACGTTTTT
>probe:Drosophila_2:1639666_at:457:13; Interrogation_Position=2619; Antisense; ATTAGAGAGAGCACCATTACCCCTT
>probe:Drosophila_2:1639666_at:609:13; Interrogation_Position=2634; Antisense; ATTACCCCTTAGGATATCGCAAAGT
>probe:Drosophila_2:1639666_at:120:31; Interrogation_Position=2662; Antisense; ATAAAATCTCGTTCACAGGACAATA
>probe:Drosophila_2:1639666_at:296:243; Interrogation_Position=2696; Antisense; AATTTAAGTGGCTTGCACCGACGAA
>probe:Drosophila_2:1639666_at:725:169; Interrogation_Position=2810; Antisense; AAAGTCTCATATTTGTTTGTTTCAG

Paste this into a BLAST search page for me
TGGTATGTTCCAAACCAAGGCGAACGAAATCGTGGTCAATGCGGAAAGCAGCAGAGGCTATACCCACAGATTACTGATTACTCCACATTTAAGAACCGGGGAACCGGGTTTTGCTACTGCGAACGACGAAGTATCAGTTTTGCGAAAAGCGACTCCACGCATCTGGAGAAGGCTTGAGAAGGCTTGCTACTGGCTGCTAAGCTACTGGCTGCTAATAACGTTTTTATTAGAGAGAGCACCATTACCCCTTATTACCCCTTAGGATATCGCAAAGTATAAAATCTCGTTCACAGGACAATAAATTTAAGTGGCTTGCACCGACGAAAAAGTCTCATATTTGTTTGTTTCAG

Full Affymetrix probeset data:

Annotations for 1639666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720