FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639668_at:

>probe:Drosophila_2:1639668_at:49:283; Interrogation_Position=1673; Antisense; CTCCCTGGATCTCCCAGAGATCAAG
>probe:Drosophila_2:1639668_at:584:525; Interrogation_Position=1698; Antisense; GGGAATCACAGAAAATTTCGTACCT
>probe:Drosophila_2:1639668_at:9:387; Interrogation_Position=1708; Antisense; GAAAATTTCGTACCTTGGTGACCAG
>probe:Drosophila_2:1639668_at:396:243; Interrogation_Position=1711; Antisense; AATTTCGTACCTTGGTGACCAGCTA
>probe:Drosophila_2:1639668_at:72:637; Interrogation_Position=1715; Antisense; TCGTACCTTGGTGACCAGCTATATA
>probe:Drosophila_2:1639668_at:392:527; Interrogation_Position=1724; Antisense; GGTGACCAGCTATATAGGTAAACAA
>probe:Drosophila_2:1639668_at:153:185; Interrogation_Position=1744; Antisense; AACAAACGAATGGTCGATGTCCTTT
>probe:Drosophila_2:1639668_at:273:369; Interrogation_Position=1751; Antisense; GAATGGTCGATGTCCTTTAACTTTT
>probe:Drosophila_2:1639668_at:513:535; Interrogation_Position=1755; Antisense; GGTCGATGTCCTTTAACTTTTGATT
>probe:Drosophila_2:1639668_at:244:503; Interrogation_Position=1762; Antisense; GTCCTTTAACTTTTGATTATCTCTC
>probe:Drosophila_2:1639668_at:497:461; Interrogation_Position=1776; Antisense; GATTATCTCTCACTTTCTTTACTTA
>probe:Drosophila_2:1639668_at:581:685; Interrogation_Position=1779; Antisense; TATCTCTCACTTTCTTTACTTACAC
>probe:Drosophila_2:1639668_at:480:651; Interrogation_Position=1785; Antisense; TCACTTTCTTTACTTACACCTTTCT
>probe:Drosophila_2:1639668_at:249:667; Interrogation_Position=1795; Antisense; TACTTACACCTTTCTTAACGAGTAT

Paste this into a BLAST search page for me
CTCCCTGGATCTCCCAGAGATCAAGGGGAATCACAGAAAATTTCGTACCTGAAAATTTCGTACCTTGGTGACCAGAATTTCGTACCTTGGTGACCAGCTATCGTACCTTGGTGACCAGCTATATAGGTGACCAGCTATATAGGTAAACAAAACAAACGAATGGTCGATGTCCTTTGAATGGTCGATGTCCTTTAACTTTTGGTCGATGTCCTTTAACTTTTGATTGTCCTTTAACTTTTGATTATCTCTCGATTATCTCTCACTTTCTTTACTTATATCTCTCACTTTCTTTACTTACACTCACTTTCTTTACTTACACCTTTCTTACTTACACCTTTCTTAACGAGTAT

Full Affymetrix probeset data:

Annotations for 1639668_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720