FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639669_at:

>probe:Drosophila_2:1639669_at:102:459; Interrogation_Position=122; Antisense; GATATCTGCCTGTCGAAGATGCTTC
>probe:Drosophila_2:1639669_at:336:343; Interrogation_Position=142; Antisense; GCTTCAGTGCATCAAATCGTTCCTA
>probe:Drosophila_2:1639669_at:708:469; Interrogation_Position=160; Antisense; GTTCCTAACGAGTCATTGTCTGCAG
>probe:Drosophila_2:1639669_at:233:141; Interrogation_Position=245; Antisense; ACGGACCCCATTATCACCTAGAAGG
>probe:Drosophila_2:1639669_at:563:615; Interrogation_Position=312; Antisense; TGAATCGCATGATCCTATCCACGGA
>probe:Drosophila_2:1639669_at:67:661; Interrogation_Position=369; Antisense; TAACCAACAACTCGAGGCACCATTT
>probe:Drosophila_2:1639669_at:575:109; Interrogation_Position=396; Antisense; AGAAGTTCATGGATCCCACCATCAG
>probe:Drosophila_2:1639669_at:686:547; Interrogation_Position=444; Antisense; GGAGGCACCATATCACGGAACTCAT
>probe:Drosophila_2:1639669_at:677:7; Interrogation_Position=506; Antisense; ATTGCCCCAGGGTTCATAGTCCAGC
>probe:Drosophila_2:1639669_at:704:25; Interrogation_Position=521; Antisense; ATAGTCCAGCTTATGCCACCGATGG
>probe:Drosophila_2:1639669_at:557:65; Interrogation_Position=542; Antisense; ATGGTCATCTCTGCTACAGGGTGGA
>probe:Drosophila_2:1639669_at:522:701; Interrogation_Position=587; Antisense; TTTTGAACTGCCTGCGTCGCAATGA
>probe:Drosophila_2:1639669_at:335:223; Interrogation_Position=62; Antisense; AAGGATCCTTTCTGCGCAGATCGGA
>probe:Drosophila_2:1639669_at:115:35; Interrogation_Position=94; Antisense; ATCTTAGAAGCGAAGGTTCCCCAGA

Paste this into a BLAST search page for me
GATATCTGCCTGTCGAAGATGCTTCGCTTCAGTGCATCAAATCGTTCCTAGTTCCTAACGAGTCATTGTCTGCAGACGGACCCCATTATCACCTAGAAGGTGAATCGCATGATCCTATCCACGGATAACCAACAACTCGAGGCACCATTTAGAAGTTCATGGATCCCACCATCAGGGAGGCACCATATCACGGAACTCATATTGCCCCAGGGTTCATAGTCCAGCATAGTCCAGCTTATGCCACCGATGGATGGTCATCTCTGCTACAGGGTGGATTTTGAACTGCCTGCGTCGCAATGAAAGGATCCTTTCTGCGCAGATCGGAATCTTAGAAGCGAAGGTTCCCCAGA

Full Affymetrix probeset data:

Annotations for 1639669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720