Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639670_at:

>probe:Drosophila_2:1639670_at:170:643; Interrogation_Position=2380; Antisense; TCTCATCATGATTTGGGACACAGCC
>probe:Drosophila_2:1639670_at:62:473; Interrogation_Position=2422; Antisense; GTTCTTTGACCATCATAAGGCCTCG
>probe:Drosophila_2:1639670_at:661:655; Interrogation_Position=2437; Antisense; TAAGGCCTCGATTAATACCATGGAA
>probe:Drosophila_2:1639670_at:53:557; Interrogation_Position=2495; Antisense; GGACAGGATTGCCAGCTGACCTTGT
>probe:Drosophila_2:1639670_at:61:119; Interrogation_Position=2508; Antisense; AGCTGACCTTGTGGGACTTTGAGCA
>probe:Drosophila_2:1639670_at:510:505; Interrogation_Position=2601; Antisense; GTGCCAATAATTTGCTGGTCAGCTC
>probe:Drosophila_2:1639670_at:239:537; Interrogation_Position=2617; Antisense; GGTCAGCTCATTTTTCACCAAGGGA
>probe:Drosophila_2:1639670_at:655:687; Interrogation_Position=2651; Antisense; TATATGATCCGCTTTACACGTCGCA
>probe:Drosophila_2:1639670_at:328:155; Interrogation_Position=2666; Antisense; ACACGTCGCAATCTCTTACTTGGTT
>probe:Drosophila_2:1639670_at:439:703; Interrogation_Position=2681; Antisense; TTACTTGGTTTCTGTGTGACTCCTC
>probe:Drosophila_2:1639670_at:134:443; Interrogation_Position=2720; Antisense; GATGTCCTCGACGTGAAGCTTAATC
>probe:Drosophila_2:1639670_at:392:561; Interrogation_Position=2773; Antisense; GGAACTCGGCGAATGGCTGGATTTT
>probe:Drosophila_2:1639670_at:428:333; Interrogation_Position=2788; Antisense; GCTGGATTTTCTAGACACCATCAAA
>probe:Drosophila_2:1639670_at:270:371; Interrogation_Position=2815; Antisense; GAAGGCTTGTTACGATCTGAAGGAC

Paste this into a BLAST search page for me
TCTCATCATGATTTGGGACACAGCCGTTCTTTGACCATCATAAGGCCTCGTAAGGCCTCGATTAATACCATGGAAGGACAGGATTGCCAGCTGACCTTGTAGCTGACCTTGTGGGACTTTGAGCAGTGCCAATAATTTGCTGGTCAGCTCGGTCAGCTCATTTTTCACCAAGGGATATATGATCCGCTTTACACGTCGCAACACGTCGCAATCTCTTACTTGGTTTTACTTGGTTTCTGTGTGACTCCTCGATGTCCTCGACGTGAAGCTTAATCGGAACTCGGCGAATGGCTGGATTTTGCTGGATTTTCTAGACACCATCAAAGAAGGCTTGTTACGATCTGAAGGAC

Full Affymetrix probeset data:

Annotations for 1639670_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime