Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639672_at:

>probe:Drosophila_2:1639672_at:26:205; Interrogation_Position=3359; Antisense; AAGCCAGCAGCAGCGACCAAGATTT
>probe:Drosophila_2:1639672_at:459:369; Interrogation_Position=3436; Antisense; GAATGGCACTTCTGGAGGTTCACCC
>probe:Drosophila_2:1639672_at:209:127; Interrogation_Position=3457; Antisense; ACCCGTGGGTGGCAATCGCAACTAT
>probe:Drosophila_2:1639672_at:483:379; Interrogation_Position=3487; Antisense; GAACCAGCAGCATGGAGCGCCAAAT
>probe:Drosophila_2:1639672_at:415:237; Interrogation_Position=3551; Antisense; AATCTTGGCCAAAAGCAGCCCGGAG
>probe:Drosophila_2:1639672_at:292:121; Interrogation_Position=3574; Antisense; AGCGGGCTATTCCAATGCGGGCTAT
>probe:Drosophila_2:1639672_at:220:51; Interrogation_Position=3588; Antisense; ATGCGGGCTATCCAGGGCAACAGCA
>probe:Drosophila_2:1639672_at:201:413; Interrogation_Position=3690; Antisense; GACCGAATGCCAATCACTATCCAAA
>probe:Drosophila_2:1639672_at:183:239; Interrogation_Position=3713; Antisense; AATCAGCAGGGCTACGGCGGCTATC
>probe:Drosophila_2:1639672_at:471:571; Interrogation_Position=3731; Antisense; GGCTATCATCCGTTTGCGGGCAATG
>probe:Drosophila_2:1639672_at:623:653; Interrogation_Position=3820; Antisense; TAATCCGTGGGCCAGCAATGTGCCG
>probe:Drosophila_2:1639672_at:566:201; Interrogation_Position=3860; Antisense; AACCAGATGCCCCAGAACTTTATGG
>probe:Drosophila_2:1639672_at:355:353; Interrogation_Position=3910; Antisense; GCAGCCGCACTTTAACAACATGTTC
>probe:Drosophila_2:1639672_at:85:255; Interrogation_Position=3925; Antisense; CAACATGTTCGGTGGACGTCACTAG

Paste this into a BLAST search page for me
AAGCCAGCAGCAGCGACCAAGATTTGAATGGCACTTCTGGAGGTTCACCCACCCGTGGGTGGCAATCGCAACTATGAACCAGCAGCATGGAGCGCCAAATAATCTTGGCCAAAAGCAGCCCGGAGAGCGGGCTATTCCAATGCGGGCTATATGCGGGCTATCCAGGGCAACAGCAGACCGAATGCCAATCACTATCCAAAAATCAGCAGGGCTACGGCGGCTATCGGCTATCATCCGTTTGCGGGCAATGTAATCCGTGGGCCAGCAATGTGCCGAACCAGATGCCCCAGAACTTTATGGGCAGCCGCACTTTAACAACATGTTCCAACATGTTCGGTGGACGTCACTAG

Full Affymetrix probeset data:

Annotations for 1639672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime