FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639673_at:

>probe:Drosophila_2:1639673_at:720:435; Interrogation_Position=2255; Antisense; GAGGAGTTCAGTGACTTGCCGACCC
>probe:Drosophila_2:1639673_at:511:407; Interrogation_Position=2335; Antisense; GACGTCGTTGGACGATGTCCGTCAA
>probe:Drosophila_2:1639673_at:300:99; Interrogation_Position=2382; Antisense; AGAGTACGCCCAAATCGCGCAGTCG
>probe:Drosophila_2:1639673_at:291:291; Interrogation_Position=2416; Antisense; CGGTGACTCCGATTGCAGCTTTAAG
>probe:Drosophila_2:1639673_at:283:351; Interrogation_Position=2430; Antisense; GCAGCTTTAAGTCCGCCAGCGATAA
>probe:Drosophila_2:1639673_at:308:455; Interrogation_Position=2450; Antisense; GATAACGCCAAGCTGCTAGCTGGAC
>probe:Drosophila_2:1639673_at:523:35; Interrogation_Position=2549; Antisense; ATCATCGGTGATCCCATCGATTCAC
>probe:Drosophila_2:1639673_at:219:535; Interrogation_Position=2627; Antisense; GGTGAACCCACCAGCGAATCCAGAT
>probe:Drosophila_2:1639673_at:717:367; Interrogation_Position=2642; Antisense; GAATCCAGATCAACGGCAACGACAT
>probe:Drosophila_2:1639673_at:24:199; Interrogation_Position=2659; Antisense; AACGACATACTACTCGCCCATGGAG
>probe:Drosophila_2:1639673_at:257:589; Interrogation_Position=2679; Antisense; TGGAGGATCCCATGGCCACGCTAGA
>probe:Drosophila_2:1639673_at:408:445; Interrogation_Position=2702; Antisense; GATGACGTCATCATGGACCAGCTAT
>probe:Drosophila_2:1639673_at:190:339; Interrogation_Position=2722; Antisense; GCTATCCGAACCCAACTTTCAGTTG
>probe:Drosophila_2:1639673_at:98:695; Interrogation_Position=2738; Antisense; TTTCAGTTGAACTCCAGCCGCCATG

Paste this into a BLAST search page for me
GAGGAGTTCAGTGACTTGCCGACCCGACGTCGTTGGACGATGTCCGTCAAAGAGTACGCCCAAATCGCGCAGTCGCGGTGACTCCGATTGCAGCTTTAAGGCAGCTTTAAGTCCGCCAGCGATAAGATAACGCCAAGCTGCTAGCTGGACATCATCGGTGATCCCATCGATTCACGGTGAACCCACCAGCGAATCCAGATGAATCCAGATCAACGGCAACGACATAACGACATACTACTCGCCCATGGAGTGGAGGATCCCATGGCCACGCTAGAGATGACGTCATCATGGACCAGCTATGCTATCCGAACCCAACTTTCAGTTGTTTCAGTTGAACTCCAGCCGCCATG

Full Affymetrix probeset data:

Annotations for 1639673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720