FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639676_at:

>probe:Drosophila_2:1639676_at:543:69; Interrogation_Position=1013; Antisense; AGGCCTTCGACACGCTCATAAATGT
>probe:Drosophila_2:1639676_at:213:477; Interrogation_Position=1036; Antisense; GTTTATGGTGCCGTTAACGACGCCT
>probe:Drosophila_2:1639676_at:414:659; Interrogation_Position=1077; Antisense; TAACATCAGTGTGGCGTACGTAAAC
>probe:Drosophila_2:1639676_at:106:669; Interrogation_Position=1111; Antisense; TACGCCGAGGCAAGGGAGACCCTTT
>probe:Drosophila_2:1639676_at:607:131; Interrogation_Position=1174; Antisense; ACCCAGGAAGGCATTCTGCAGGCAA
>probe:Drosophila_2:1639676_at:266:165; Interrogation_Position=1197; Antisense; AAATCTGGGTTTGGTGTATCTTCGC
>probe:Drosophila_2:1639676_at:667:481; Interrogation_Position=1212; Antisense; GTATCTTCGCGAGGGCCTGATGTCG
>probe:Drosophila_2:1639676_at:715:381; Interrogation_Position=1245; Antisense; GAACGCTTGCCGACTGGCGTGGAAA
>probe:Drosophila_2:1639676_at:7:101; Interrogation_Position=1302; Antisense; AGAGCAGGCCGAGTATTGTCTCAAC
>probe:Drosophila_2:1639676_at:615:123; Interrogation_Position=1355; Antisense; AGCGCCAGTGAGGATTCTTTTTACA
>probe:Drosophila_2:1639676_at:222:341; Interrogation_Position=851; Antisense; GCTTTCAAGGGTTCACTTGGACCTT
>probe:Drosophila_2:1639676_at:94:151; Interrogation_Position=865; Antisense; ACTTGGACCTTGCAGCAGTTGGCTA
>probe:Drosophila_2:1639676_at:656:47; Interrogation_Position=904; Antisense; ATGCCCGACGACAAGGACATACTGG
>probe:Drosophila_2:1639676_at:36:257; Interrogation_Position=944; Antisense; CAAAGAATTGGTTCGGGCAGCTGCT

Paste this into a BLAST search page for me
AGGCCTTCGACACGCTCATAAATGTGTTTATGGTGCCGTTAACGACGCCTTAACATCAGTGTGGCGTACGTAAACTACGCCGAGGCAAGGGAGACCCTTTACCCAGGAAGGCATTCTGCAGGCAAAAATCTGGGTTTGGTGTATCTTCGCGTATCTTCGCGAGGGCCTGATGTCGGAACGCTTGCCGACTGGCGTGGAAAAGAGCAGGCCGAGTATTGTCTCAACAGCGCCAGTGAGGATTCTTTTTACAGCTTTCAAGGGTTCACTTGGACCTTACTTGGACCTTGCAGCAGTTGGCTAATGCCCGACGACAAGGACATACTGGCAAAGAATTGGTTCGGGCAGCTGCT

Full Affymetrix probeset data:

Annotations for 1639676_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720