Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639677_at:

>probe:Drosophila_2:1639677_at:461:31; Interrogation_Position=2873; Antisense; ATAAACACACCCAAGCACGCATGTG
>probe:Drosophila_2:1639677_at:88:517; Interrogation_Position=2901; Antisense; GTGTGCAATGCAGGCCGCAGTTAAG
>probe:Drosophila_2:1639677_at:181:349; Interrogation_Position=2910; Antisense; GCAGGCCGCAGTTAAGCAGATGCAA
>probe:Drosophila_2:1639677_at:8:479; Interrogation_Position=2948; Antisense; GTTTATTTTAATTCACGCTTCGGCT
>probe:Drosophila_2:1639677_at:481:709; Interrogation_Position=2955; Antisense; TTAATTCACGCTTCGGCTACAAAAG
>probe:Drosophila_2:1639677_at:613:339; Interrogation_Position=2970; Antisense; GCTACAAAAGCCAGCGTCCTCCATT
>probe:Drosophila_2:1639677_at:20:101; Interrogation_Position=3053; Antisense; AGAGAGGGAGTAGCTCCACTCCGCT
>probe:Drosophila_2:1639677_at:621:131; Interrogation_Position=3093; Antisense; ACCGCATTTTTCTTGCCTTGTGCTG
>probe:Drosophila_2:1639677_at:410:507; Interrogation_Position=3119; Antisense; GTGCTCCCTTTTTGTATCTTTGTAT
>probe:Drosophila_2:1639677_at:568:685; Interrogation_Position=3149; Antisense; TATCTTTTTGTTTTTGTGCCTCGGC
>probe:Drosophila_2:1639677_at:701:699; Interrogation_Position=3175; Antisense; TTTTCTTCCCGACTTCGTTGCGAAT
>probe:Drosophila_2:1639677_at:309:365; Interrogation_Position=3196; Antisense; GAATTTGTTTAGTACAGCGTCGTTA
>probe:Drosophila_2:1639677_at:263:257; Interrogation_Position=3210; Antisense; CAGCGTCGTTAGTAATGCCGTTTAA
>probe:Drosophila_2:1639677_at:407:93; Interrogation_Position=3333; Antisense; AGTTCTTAACATTTGTCAAGCCACA

Paste this into a BLAST search page for me
ATAAACACACCCAAGCACGCATGTGGTGTGCAATGCAGGCCGCAGTTAAGGCAGGCCGCAGTTAAGCAGATGCAAGTTTATTTTAATTCACGCTTCGGCTTTAATTCACGCTTCGGCTACAAAAGGCTACAAAAGCCAGCGTCCTCCATTAGAGAGGGAGTAGCTCCACTCCGCTACCGCATTTTTCTTGCCTTGTGCTGGTGCTCCCTTTTTGTATCTTTGTATTATCTTTTTGTTTTTGTGCCTCGGCTTTTCTTCCCGACTTCGTTGCGAATGAATTTGTTTAGTACAGCGTCGTTACAGCGTCGTTAGTAATGCCGTTTAAAGTTCTTAACATTTGTCAAGCCACA

Full Affymetrix probeset data:

Annotations for 1639677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime